Table 1.

Primer sequences.

NDRG1 forwardTCAAGATGGCGGACTGTG
NDRG1 reverseGAAGGCCTCAGCGAGCTT
GAPDH forwardCTCTCTGCTCCTCCTGTTCGAC
GAPDH reverseTGAGCGATGTGGCTCGGCT
OCT4 forwardATGTGGGGCTCACCCTGGGG
OCT4 reverseCTTCTGCAGCAAGGGCCGCA
SOX2 forwardGCCGAGTGGAAACTTTTGTCG
SOX2 reverseGGCAGCGTGTACTTATCCTTCT