Table 2.

siRNA oligonucleotides

TargetGenBank accession no.Sense strand sequence: 5′-…-3′
Human ADAM10NM_001110GCUAAUGGCUGGAUUUAUU
GGACAAACUUAACAACAAU
CCCAAAGUCUCUCACAUUA
GCAAGGGAAGGAAUAUGUA
Luciferase (control)CGUACGCGGAAUACUUCGATT
Human ezrinNM_003379AACCCCAAAGAUUGGCUUUCC
Human radixinNM_002903AAGCAGUUGGAAAGGGCACAA
Human moesinNM_002444AGAUCGAGGAACAGACUAAGA