Table 1.

Overview of enriched RNA sequences after selection against human pro-uPA.

CloneSequence of variable regionAbundance among sequenced clones, %Inhibitory in activity assaya
101UUAUCGUACCGUGCUGUGGUUAACGAUAUCUACUC1.8No
108GUUCCUGGACCGCGCUGUGGCCAGGAUCAUCAAAU1.8No
126CAUUCGCACGCUGUGUGGGGAUUAGUCCCGAUGUU50.9Yes
130UGGCAUACCGAUACUGUGGUUAUGAGAUUUGCAGC1.8No
201GGCGUACUGCGCUGUAGUUGCACCAUUACAAGAUC3.5No
226UAUCGAAUUGAUAACCUUACGCGAGAGCGUAGUUC24.6No
231CAUGCAUUGCGGGAGCGCUAGCUCCUCAGGUACUA3.5Yes
246UGCUCACCGCGCUGUGGUCGAGCAAUGCAUUAUAC8.8No
250ACUUUCGAAGGCCGAGUGCUGUCGAAGGGACAUUA3.5No
  • NOTE: The sequences of unique variable regions obtained after 12 rounds of selection are shown as well as their abundance among the 84 sequenced clones

  • aUnique sequences were screened for inhibitory function in a coupled plasminogen activation assay (see Fig. 1).