Table 1.

Primers used for PCR and RT-PCR

ForwardReverse
uPARCATGCAGTGTAAGACCCAACGGGGAAATAGGTGACAGCCCGGCCAGAGT
uPATGCGTCCTGGTCGTGAGCGACAAGCGTGTCAGCGCTGTAG
GAPDHCGGAGTCAACGGATTTGGTCGTATAGCCTTCTCCATGGTGGTGAAGAC