Table 1.

Primer Sequences Used for Quantitative Real-time PCR

TargetForward primer (5′-3′)Reverse primer (5′-3′)
CerS1 variant 1ACGCTACGCTATACATGGACACAGGAGGAGACGATGAGGATGAG
CerS1 variant 2ACGCTACGCTATACATGGACACGGAGACGATGAGGATGAGAGTG
CerS2CCGATTACCTGCTGGAGTCAGGGCGAAGACGATGAAGATGTTG
CerS3ACATTCCACAAGGCAACCATTGCTCTTGATTCCGCCGACTCC
CerS4CTTCGTGGCGGTCATCCTGTGTAACAGCAGCACCAGAGAG
CerS5GCCATCGGAATCAGGACGCCAGCACTGTCGGATGT
CerS6GGGATCTTAGCCTGGTTCTGGGCCTCCTCCGTGTTCTTCAG
β-actinACCTGACTGACTACCTCATGAAGAGCGACGTAGCACAGCTTCTC