Table 2.

Primer Information of Genes Used for Quantitative RT-PCR

Accession NumberGeneSense PrimerAntisense Primer
NM_001315MAPK14TTCTGTTGATCCCACTTCACTGTACACACATGCACACACACTAAC
NM_002754MAPK13CCCCAGGAAGGATTTCACTCAGCTTGTCCACGTCTAGCTCCAG
NM_000389CDKN1AGACACTGGCCCCTCAAATCGCTCCTTGTTCCGCTGCTAATCA
NM_002648PIM1GAGAAGGAGCCCCTGGAGTCAAGTTGTCGGAGACGCGGAT
NM_153487MDGA1GGCTGTGTGGCGTTTCAAAGTTGGAGACGCTGCACTCGTA
NM_152733BTBD9CCTGCCTCCTTCATCCGTATCCTGTCCCCGATTCCTCACTATTT
NM_001371DNAH8CAGCCACGAACTCAGAAACTGTCACTCTCAATAAGTACCTGTTCG
NM_001760CCND3GCCACTAAGCAGAGGAGGGGGGGGATGGGTAGGACCAGATC
NM_002821PTK7TCCTTCAGTGAGATTGCCAGCCTAGAGATGTCCTCCCCTGCC
NM_001253CDC5LTCTCTGAAGCTCCTCTCGGCCATCCTCGGTATTCCTCCATACG
NM_001024630RUNX2GCCCCCAAACAGTATCTTGAGCCTGAAGTGAGGTTTTAGGC