Table 1.

Sequences of PCR Primer Sets Used for the Preparation of RPA Probes

Product size (bp)Upper primer (5′-3′)Lower primer (5′-3′)Annealing Tm (°C)
GAPDH296AGCCCATCACCATCTTCCAGATGAGCCCTTCCACAATGCC57.4
Class I312TTCATTGGAAACAGCACAGCGAAACTGGAGGACAAAGGGC56.6
Class II177GTGACATCCCTCCTCGTGCTTTCCCTAACCTGCTTG55.5
Class III244CAACAGCACGGCCATCCAGGCTTGGGGCCCTGGGCCTCCGA56.6
Class IVa271GGACGAGATGGAGTTTACGCAGCAAATAGAAGCAACCTGG55.8
Class IVb344GTCCAAAACAAGAACAGCAGCTCTAAGCCACCTCCTCCTC55.2
MDR1258TCGCAAAAGCATCTGTGGAAGTTGCTGTTCTGCCGC53.2