Table 4.

Oligonucleotide Primers Used in the PCR Direct Sequencing for EGFR in Exons 18, 19, 20, and 21

Forward primerReverse primerProduct size (bp)
Exon 18CTCTGGCTCAGAATGAATCTACGAAGCCTAGTGCGGACCTGTC268
Exon 19CCAGCTCACAAGGCAACATGCTAAGGAAGCAAGATTGACC229
Exon 20GATTCATCTATTGTCCTTACCTGGGTACTTCAGTGGACAGAC234
Exon 21CATGACACTGAGGATGCCCAGACAAATGCTGCCCACAGCTGAC298