Table 1.

Sequences of Primers Used in Quantification Real-time Reverse Transcription-PCR

Gene IDSequence
p21CAGCGACCTTCCTCATCCAForward primer
CCCATCCCTCCCCAGTTCATTGC5′[6-FAM]-3′ [TAMRA]-probe
GACTCCTTGTTCCGCTGCTAAReverse primer
Cdc2CATTTGGAGTATAGGCACCATATTTGForward primer
TGAACTAGCAACTAAGAAACCACTTTTCCATGGG5′[6-FAM]-3′ [TAMRA]-probe
TCTGAAAATCCTGAAGAGTTGATCAReverse primer
Cdc25CGCTACTGCCCTATGCATCATCAForward primer
TGGCTTCGACACCTCAGCAACTCAGTCT5′[6-FAM]-3′ [TAMRA]-probe
CCCCTTCCTGCACTTTGCTReverse primer
Chk1TGGTTGACTTCCGGCTTTCTForward primer
AAGTGTCTCTTGAACTCCAATCCATCACCCT5′[6-FAM]-3′ [TAMRA]-probe
TCAATCAGCTTCCCTTTAATCTTCAReverse primer
Topoisomerase IIαGAGTAGTTATGTGATTATTTCAGCTCTTGACForward primer
TGTCCCCTCTGGCTGCCTCTGAGTC5′[6-FAM]-3′ [TAMRA]-probe
TTGGTTTCTCTCTTTGGGAGATTCReverse primer
SurvivinGGAGTCTGGGAAGGGTTGTGForward primer
CCTCACCCATAGCCCAGAAGCCTCAT5′[6-FAM]-3′ [TAMRA]-probe
GGCTCTAACCTGCCATTGGAReverse primer