Table 1.

Identity of the Primer Pairs Employed for Rat Prostate Cancer Cell Transcript Amplification

Accession No.Sense Primer (5′→3′)Antisense Primer (5′→3′)
AS3*U95825ACACCAAAAATTATCTGCCTCCAAGCCTCCCCTTTATTCTTCC
FGFR1NM_024146CGATGATGATGACTCCTCCTTCCGTAGATGAAGCACC
FGFR2M97193TGGTGGAGAATGAATACGGGTCCTGTTACCACCATACAGGCGATTAA
FGFR3NM_053429CTCCTTACTGGACTCGACCGAAAACCCGATAGAATTGC
FGFR4M91599ATCTGGAGTCTCGGAAGTGCCCCTCATTAGCCCATACAGC
GADD34 (Myd116)NM_133546TCCTGCACTGGAAGGAAGCCACACCCTCTTCTCTAGCCACC
GADD45α (DDIT1)NM_024127AAGATCGAAAGGATGGACACGGTAGCAACAGCTCTGCCAGC
GADD45γ (OIG37)NM_133546CCAAAGTCCTGAATGTGGACCCCTCGCAGAACAAACTGAGC
GADD153 (DDIT3)NM_024134TTTGAGACAGTGTCCAGCCACTTTCCTCTCATTCTCC
GAS1X65128CTACAGCCAGTACGCCGAGTGCAGCCCATGACC
GAS220829915AAGAAGATTCCTTGCAAAGCGGTATCGACCTTGAGAGAGC
GAS3 (PPM2)NM_017037AGCTCTTCACTCTCACCAAAGGAGGATGTAAGCAAAGCCATAGG
GAS5X59728ACGAGGACTCGTCAGGAAGCTTGTACCCAAGCAAGCCAGC
GAS6NM_057100ACCAATGCACCCCAAACCAGGCTGGAGCCTCTTGAAGC
GAS7NM_008088AGTCTCCCGAAAATCCACCGCTCAACTTGATCTCCAGC
GAS8U19859CGACATCACTCTCAACAACCGCCAGCTCATACTGTAAGTCC
GAS11NM_018855AACGACATCACTCTCAACAACCAGCACCTCATTGAACTGAACC
  • * Primers were designed to amplify rat sequence having high homology to the reported sequence for human AS3 (27).

  • Primers were designed to encompass the alternately spliced sequences encoding either FGFR2(IIIb) or FGFR2(IIIc) and have been detailed by others (9).