Advertisement
Signaling and Regulation

Pirh2, a Ubiquitin E3 Ligase, Inhibits p73 Transcriptional Activity by Promoting Its Ubiquitination

Hong Wu, Zeinab Rami Abou, Elsa R. Flores and Roger P. Leng
DOI: 10.1158/1541-7786.MCR-11-0157 Published December 2011

Abstract

p73, a homolog of the tumor suppressor p53, transactivates many p53 target genes, leading to apoptosis or cell-cycle arrest. p73 has recently been reported to play an important role in tumor suppression in a mouse model. Here, we show that Pirh2 physically interacted with p73 and downregulated p73 function through its E3 ligase activity. Pirh2 promoted p73 ubiquitination in vivo and in vitro. Intriguingly, Pirh2 primarily used K63-linked chains to ubiquitinate p73 in vitro, but in vivo, Pirh2 utilized K11-, K29-, K48-, and K63-linked chains to promote p73 ubiquitination. Depletion of Pirh2 by siRNA significantly reduced the ubiquitination of p73 in p53 null cells. Ectopic expression of Pirh2 repressed p73-dependent transcriptional activity, but the levels of p73 were not decreased. We consistently showed that ablation of endogenous Pirh2 restored p73-mediated transactivational activity. We found that Pirh2 repressed p73 transcriptional activity by directly inhibiting the p73 transcript, and p73 repression by Pirh2 was required for p73-dependent transcriptional activity and G1 arrest but not for apoptosis. This study provides evidence that the ubiquitination of p73 mediated by Pirh2 represents an important pathway for controlling the suppressive function of p73. Furthermore, the data suggest a link between the transcriptional activity of p73 and its ubiquitination. Mol Cancer Res; 9(12); 1780–90. ©2011 AACR.

Introduction

p73 is a homolog of p53 and is capable of inducing apoptosis in cells or cell-cycle arrest (1–4). Although p73 has apoptotic activity, it is rarely mutated in human tumors, and p73-deficient mice are not tumor prone and do not display an increase in tumor incidence (5, 6). However, a number of studies have recently shown that p73 expression is lost or reduced in certain human tumors (through LOH or allelic silencing), implying that p73 has tumor suppressor capabilities (7–9). Flores and colleagues (2005) have shown that p73+/− mice develop spontaneous tumors, and loss of p73 can cooperate with loss of p53 in tumor suppression. In addition, mutation in p73 combined with p53 mutations lead to a more aggressive tumor phenotype, indicating that p73 plays an important role in tumor suppression in a mouse model (10). The protein Itch has been reported to function as an E3 ligase for p73 (11), but multiple pathways are involved in controlling p73.

Pirh2 is a RING finger E3 ligase that binds to and promotes p53 degradation (12–15). Overexpression of Pirh2 in mouse tumors is accompanied by low p53 protein expression, but the levels of MDM2, an E3 ubiquitin ligase that is known to regulate p53 stability, remain unchanged (16, 17). E3 ubiquitin ligases often control the ubiquitination of multiple substrates (18, 19); for example, Pirh2 binds the androgen receptor (AR, 20) and diminishes the interaction between the AR N-terminus and its C-terminus. Pirh2 also binds to Tip60 (21), which is an acetyltransferase that is involved in transcriptional regulation. Tip60 enhances Pirh2 protein stability and alters the subcellular localization of Pirh2 (21). Another target of Pirh2 is hNTKL-BP1 (N-terminal kinase-like protein-binding protein 1), a protein that is involved in mitosis-related cellular functions through its binding of NTKL (22). Logan and colleagues (2006) have reported that human Pirh2 (hPirh2) is involved in prostate cancer cell proliferation; overexpression of hPirh2 was detected in 73 of 82 (89%) resected prostate cancers, and a strong correlation was observed between hPirh2 expression and tumor aggressiveness (23). Pirh2 has also been reported to promote ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor p27Kip1 (24).

In this study, we found that Pirh2 physically interacted with p73 in vitro and in vivo, and we showed that Pirh2 repressed p73-dependent transcriptional activity. Our findings revealed that Pirh2-mediated ubiquitination of p73 was linked to the inhibition of the transactivational activity of p73. We showed that depletion of Pirh2 by siRNA markedly reduced the ubiquitination of p73 in p53 null cells. We further showed that Pirh2 repressed p73 transcriptional activity by directly inhibiting the p73 transcript, and p73 repression by Pirh2 was required for p73-dependent transcriptional activity and G1 cell-cycle arrest but not for apoptosis.

Materials and Methods

Plasmids and antibodies

pcDNA3-Pirh2, GST-Pirh2, and p21-Luc have previously been described (12). Myc-Pirh2 and Myc-Pirh2 mutants were generated by PCR amplification and subcloned into the pcDNA3.1-Myc vector. Myc-AIP4 and the Myc-AIP4 mutant (C830A) were provided by Dr. T. Pawson. His-p73α and His-p73β were PCR amplified and subcloned into pET15b. All ubiquitin and ubiquitin mutants were PCR amplified and subcloned into pET28a. Flag-p73α, Flag-p73β, and Flag-p73 mutants were generated by PCR and subcloned into pCMV-Tag1 (Agilent Technologies). All PCR products were confirmed by sequencing. The p73-specific antibodies (ER-15, Abcam; H-79, Santa Cruz Biotechnology), anti-p73 delta N antibody (38C674, Abcam), anti-Myc antibody (9E10, Roche), anti-Flag antibody (M5, M2, Sigma), anti-GST antibody (B-14; Santa Cruz Biotechnology), anti-HA antibody (12CA5; Roche), anti-ubiquitin antibody (BD Biosciences), and anti-actin antibody (Sigma) were used according to manufacturer's instructions. The Pirh2 polyclonal antibody has previously been described (12).

Cell culture and DNA transfection

All cells were maintained in α-minimal essential medium supplemented with 10% FBS. H1299 cells and Saos-2 cells were transfected using the previously described calcium phosphate method (12).

siRNA experiments

For siRNA experiments, HCT116 p53−/− cells were transfected with the indicated siRNA constructs using Lipofectamine 2000 (Invitrogen). The following sequences were used: Pirh2 siRNA1, CCTTGCTGTGACAAGCTTT; Pirh2 siRNA2, GCTTTAAAGTGAAGGAAGT; and control siRNA, CTTATGTGACCAGCTGCTT. The following AIP4 target sequences (11) were used: AAGTGCTTCTCAGAATGATGA and AACCACAACACACGAATTACA; the scrambled sequence was AATTCTCCGAACGTGTCACGT.

Expression and recombinant protein preparation

All GST- or His-tagged recombinant proteins were expressed in E. coli strain BL21 (DE3; Novagene), treated with isopropyl-β-d-thiogalactoside to induce fusion protein expression, and purified using Glutathione Sepharose 4B (GE Healthcare) for glutathione S—transferase (GST) fusion proteins or Ni2+-NTA agarose (Qiagen) for His fusion proteins.

Immunoprecipitation and measurement of p73 half-life

Cells were lysed in 50 mmol/L Tris-HCl (pH 8.0), 5 mmol/L EDTA, 150 mmol/L NaCl, 0.5% NP-40, and a protease inhibitor tablet (Roche) and immunoprecipitated with the indicated antibodies. The immune complexes were collected with protein A agarose beads and washed 4 times with the same lysis buffer. The immunoprecipitates were analyzed by SDS-PAGE followed by autoradiography. To measure the p73 half-life, Saos-2 cells were cotransfected with plasmids expressing Pirh2, AIP4, and p73α. Twenty-four hours after transfection, the cells were treated with 25 μg/mL cycloheximide (CHX) to inhibit de novo protein synthesis, and the protein levels were monitored by immunoblotting with the ER-15 antibody (to measure p73) at the indicated time points. The relative amount of p73 protein was determined by densitometry and normalized to β-actin.

In vitro ubiquitination assay

The in vitro ubiquitination assay was done as previously described with some modifications (12, 25). For Pirh2-mediated ubiquitination, the reactions were done by adding E1 (20–40 ng; Calbiochem), E2 (UbcH5b, 100 ng; Calbiochem), ubiquitin or His-ubiquitin (3–5 μg; Sigma), His-p73 and GST-Pirh2 (0.2–0.5 μg) in ubiquitination buffer [50 mmol/L Tris-HCl (pH 7.4), 2 mmol/L ATP, 5 mmol/L MgCl2, and 2 mmol/L DTT] to a final volume of 30 μL. The reactions were incubated at 30°C for 1.0 to 1.5 hours. The reactions were stopped with 2× SDS loading buffer, resolved by SDS-PAGE gels and analyzed by Western blot.

To eliminate possible autoubiquitination of Pirh2 in the coupled in vitro ubiquitination/immunoprecipitation (IP), the mixtures were incubated for 2 hours, immunoprecipitated with the ER-15 (anti-p73) monoclonal antibody (mAb) and protein A agarose beads, rotated at 4°C for 2 to 3 hours, washed with radioimmunoprecipitation assay (RIPA) buffer, separated by 10% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and analyzed by Western blot.

In vivo ubiquitination assay

Cells were transfected with expression plasmids encoding p73, Pirh2, AIP4, and HA-tagged ubiquitin or various HA-ubiquitin mutants either alone or in combination. After 30 hours, the cells were harvested, lysed, and immunoprecipitated with the indicated antibodies. The immune complexes recovered by protein A Sepharose were washed 4 times with RIPA buffer, separated by 10% SDS-PAGE, and analyzed by immunoblotting as previously described (12, 25).

Chromatin immunoprecipitation

Chromatin IP (ChIP) was done as previously described (12).

Luciferase assay

As previously described (12), pGL3-E1bTATA contains a minimal promoter consisting of a TATA box downstream of one copy of the p73 binding site from the 5′ end of the p21WAF promoter; this construct is referred to as p21-Luc. A β-galactosidase reporter construct, pCMV-β-gal (Promega), was included in all of the transfection reactions. Luciferase activity was measured 2 days posttransfection in samples containing equivalent amounts of protein using an LB9507 luminometer and a luciferase assay reagent (Promega). The values were normalized to β-galactosidase activity.

Statistical analysis

Statistical significance was determined using the 2-tailed Student t test and expressed as a P value.

Results

Pirh2 physically interacts with p73

In our previous study, Pirh2 was shown to bind to the p53 DNA binding domain (12), which is highly conserved in p73 (60%–80%, 1–4). On the basis of these data, we first investigated whether Pirh2 interacted with p73 in vivo. p53 null Saos-2 cells were transfected with plasmids expressing Flag-p73α and Flag-p73β or with these plasmids combined with Myc-Pirh2, immunoprecipitated with the indicated antibodies, and analyzed by Western blot. The data showed that Pirh2 coimmunoprecipitated with p73α and p73β (Fig. 1A and B). To determine whether endogenous p73 and Pirh2 interacted under physiologic conditions in the absence of overexpression, an IP/Western blot experiment was done using extracts prepared from human HEK293 cells. We observed that (i) p73 was present in the anti-Pirh2 immunoprecipitates, but not in the control rabbit IgG sample, and that (ii) Pirh2 was present in the anti-p73 immunoprecipitates, but not in the control mouse IgG sample (Fig. 1C). Next, we carried out an in vitro Ni2+ pull-down assay, which revealed that GST-Pirh2 bound to His-p73α and His-p73β but not to His alone (Fig. 1D). Thus, we concluded that p73 and Pirh2 physically interact in vivo and in vitro.

Figure 1.
Figure 1.

Pirh2 interacts with p73. A, Saos-2 cells were transfected with plasmids expressing Flag-p73α and Flag-p73β either alone or in combination with Myc-Pirh2, immunoprecipitated with an anti-Myc antibody, and analyzed by Western blot using an anti-Flag antibody (M5) for p73 and an anti-Myc antibody for Pirh2 as indicated. Direct Western blots for p73α, p73β, and Pirh2 are shown in the bottom panels. B, similar to (A), except that the cell extracts were immunoprecipitated with anti-Flag and immunoblotted with anti-Myc and anti-Flag antibodies as indicated. Direct Western blots for p73α, p73β, and Pirh2 are shown in the bottom panels. C, HEK293 cells were immunoprecipitated with anti-p73 (ER-15) or anti-Pirh2 as indicated and immunoblotted with anti-p73 (top, ER-15) and anti-Pirh2 (bottom). Direct Western blots for p73 and Pirh2 are shown in the bottom panels. D, in vitro interaction of Pirh2 with p73 as evaluated in Ni2+ pull-down assay. GST-Pirh2, His-p73α, or His-p73β fusion proteins were affinity purified from E. coli. The ability of GST-Pirh2 to bind to His-p73α and His-p73β was analyzed by immunoblotting with an antibody against GST (GST-Pirh2). IB, immunoblotting.

Mapping the Pirh2 and p73 interaction sites

To identify the region(s) of Pirh2 that interacted with p73, a number of Pirh2 deletion mutants were generated with Myc-tagged Pirh2 or various Myc-tagged Pirh2 mutants (Fig. 2A). Saos-2 cells were cotransfected with plasmids expressing Myc-tagged Pirh2 or Myc-Pirh2 mutants and p73α. Twenty-four hours after transfection, the cells were lysed and the cell extracts were mixed with an affinity-purified His-p73α protein. Ni2+-NTA agarose was added to the mixture, and it was rotated for 2 to 3 hours at 4°C. Following extensive washing, complexes of His-p73, Myc-Pirh2, or various Myc-Pirh2 mutants were isolated on Ni2+-NTA agarose and detected by Western blot (Fig. 2B). All of the Pirh2 fragments, with the exception of an N-terminal fragment containing the first 60 amino acids, were capable of binding to p73. These results were validated upon mixing of affinity purified GST-Pirh2 and various truncated Pirh2 fusion proteins with the purified His-p73α and analysis using a GST pull-down assay with a His-specific antibody against p73 (His-p73; Fig. 2C). We further confirmed that a region of Pirh2 encompassing residues 100 to 137 was required for binding to p73 (Fig. 2C, right). To map the p73 binding site on the Pirh2 protein, Flag-tagged full-length p73 or a series of Flag-tagged p73 deletion mutants were generated and expressed in Saos-2 cells (Fig. 2E). An in vitro GST pull-down assay was done, and cell extracts prepared from Saos-2 cells expressing p73 or various p73 deletion mutants were mixed with purified GST-Pirh2. As shown in Fig. 2F, full-length p73 and p73 123–313 (DNA binding domain) bound to immobilized GST-Pirh2 but not to other p73 deletion mutants. Thus, these data indicated that the DNA binding domain of p73 is important for its interaction with Pirh2.

Figure 2.
Figure 2.

Mapping the Pirh2 and p73 interaction sites. A, cell extracts prepared from Saos-2 cells ectopically expressing Myc-Pirh2 and various truncated forms of Myc-Pirh2 were analyzed by Western blot. B, the region of Pirh2 involved in binding to p73 was analyzed using a Ni2+ pull-down assay. Purified His-p73α protein was incubated with cell extracts prepared from Saos-2 cells ectopically expressing Pirh2 or Pirh2 mutants and analyzed by Western blot as indicated. An asterisk (*) indicates that the Myc-Pirh2 1–60 was unable to bind to p73. C, GST-Pirh2 and various truncated Pirh2 fusion proteins were affinity purified and analyzed by SDS-PAGE and Coomassie blue staining (top). The GST-Pirh2 proteins were mixed with purified His-p73α and analyzed by Western blot with an anti-His antibody for p73 (bottom). D, schematic representation of Pirh2 and various Pirh2 truncations. On the basis of the data provided in (B) and (C), the binding site for p73 is indicated. E, cell extracts prepared from Saos-2 cells ectopically expressing Flag-p73α and various truncated forms of Flag-p73α were analyzed by Western blot. F, the region of p73 involved in binding to Pirh2 was analyzed using a GST pull-down assay. Purified GST-Pirh2 protein was incubated with cell extracts prepared from Saos-2 cells ectopically expressing Flag-p73α or Flag-p73α mutants and analyzed by Western blot as indicated. G, schematic representation of Flag-p73 and Flag-p73 truncations. The binding site for Pirh2 is indicated and is based on the data provided in F. IB, immunoblotting.

Pirh2 promotes the ubiquitination of p73 in vivo

We next investigated whether Pirh2 promoted p73 ubiquitination in vivo. Saos-2 cells were cotransfected with plasmids encoding Flag-p73α and Flag-p73β, either alone or in combination with pcDNA3-Pirh2 and together with HA-tagged ubiquitin. p73 was immunoprecipitated with a specific mAb against the Flag epitope (M5) and analyzed by immunoblotting with an HA-specific antibody (12CA5) to detect ubiquitinated p73 (Fig. 3A, top) or with a p73-specific mAb (ER-15) to detect total p73 (Fig. 3A, bottom). As shown in Fig. 3A (top), immunoprecipitated p73α and p73β were ubiquitinated in the presence of Pirh2. Similar results were obtained using the ER-15 antibody (Fig. 3B). We further found that Pirh2ΔRING (deleted RING domain in Pirh2) was unable to promote p73α ubiquitination, indicating that the RING domain of Pirh2 is required to mediate p73α ubiquitination (Fig. 3C). Similar results were obtained with p73β (data not shown).

Figure 3.
Figure 3.

Pirh2 promotes p73 ubiquitination in vivo. A, Saos-2 cells were transfected with plasmids expressing Flag-p73α, Flag-p73β, or in combination with pcDNA3-Pirh2 and HA-tagged ubiquitin. p73 was immunoprecipitated with an anti-Flag (M5) mAb and analyzed by immunoblotting with an HA antibody (top) or with the ER-15 antibody for p73 (bottom). Direct Western blots for p73α, p73β, and Pirh2 are shown in the bottom panels. B, similar to (A) except that p73 was immunoprecipitated with anti-p73 (ER-15). C, Saos-2 cells were transfected with plasmids expressing Flag-p73α or Flag-p73α in combination with Myc-Pirh2 or Myc-Pirh2ΔRING and HA-tagged ubiquitin. p73 was immunoprecipitated with anti-Flag (M5) and analyzed by immunoblotting with an HA antibody (top) or with the ER-15 antibody for p73 (bottom). Direct Western blots for p73α and Pirh2 or Pirh2ΔRING are shown in the bottom panels. D, H1299 cells were cotransfected with plasmids expressing Flag-p73α, Flag-p73β, pcDNA3-Pirh2, and HA-ubiquitin or various HA-ubiquitin mutants as indicated. p73 was immunoprecipitated with an anti-Flag (M5) mAb and analyzed by immunoblotting with an anti-HA antibody (top) or with the ER-15 antibody for p73 (bottom). IB, immunoblotting; WB, Western blot.

To determine which lysine residue(s) of ubiquitin (Ub) was required for p73 ubiquitination by Pirh2 in vivo, we examined a number of Ub mutants. p53 null H1299 cells were cotransfected with plasmids encoding Pirh2, Flag-p73α, or Flag-p73β and HA-ubiquitin or ubiquitin mutants. p73 was immunoprecipitated with a Flag-specific antibody (M5) and immunoblotted with an HA-specific antibody to detect ubiquitinated p73 (Fig. 3D, top) or with ER-15 to detect total p73 (Fig. 3D, bottom). p73α was more heavily ubiquitinated in the presence of Pirh2 with K11, K29, K48, and K63 Ub when compared with wild-type Ub. Immunoprecipitated p73β was ubiquitinated to a lesser extent in the presence of Pirh2 with K11, K29, K48, and K63 Ub when compared with p73α ubiquitination. These data indicate that Pirh2 preferentially uses Lys-11, -29, -48, and -63 of Ub to mediate p73 ubiquitination in vivo.

Pirh2 is required for the ubiquitination of p73 in vivo

Because overexpression of Pirh2 mediated p73 ubiquitination in vivo, we next tested whether endogenous Pirh2 played a role in regulating p73 ubiquitination. To determine whether Pirh2 was required for p73 ubiquitination in vivo, p53−/− HCT116 cells were treated with the indicated siRNAs. Forty hours later, the cells were transfected with an HA-Ub expression plasmid and immunoprecipitated with an ER-15 antibody. The levels of ubiquitinated p73 were significantly lower upon treatment with Pirh2-siRNA2 when compared with treatment with the control-siRNA (Fig. 4A). Stronger polyubiquitination of p73 was detected when the cells were treated with MG132, indicating that Pirh2 promoted p73 ubiquitination (Fig. 4B). Similar results were observed in Pirh2-shA or control-shA cell lines expressing HA-Ub (Fig. 4C). Notably, the levels of p73 did not significantly change. These data showed that Pirh2 is required for p73 ubiquitination in vivo.

Figure 4.
Figure 4.

Pirh2 is required for p73 ubiquitination in vivo. A, Pirh2 is required for p73 ubiquitination in vivo. HCT116 p53−/− cells were treated with the indicated siRNAs. Forty hours later, the cells were further transfected with the plasmid encoding HA-Ub. Lysates were immunoprecipitated with anti-p73 (ER-15) and analyzed by immunoblotting with anti-HA to detect ubiquitinated p73 or with ER-15 to detect total p73. The direct Western blots for p73 and Pirh2 are shown in the bottom panel. B, similar to (A), except that after the second transfection with the HA-Ub expression plasmid, the cells were treated with the proteasome inhibitor, MG132 (20 μmol/L), for 6 hours prior to harvest. C, stable depletion of Pirh2 by siRNA in HCT116 p53−/− cells, similar to (A), except that the cells extracts were collected from HCT116 p53−/− cells clones that were stably expressing Pirh2-siRNA2 or control-siRNA. IB, immunoblotting.

Pirh2 promotes the ubiquitination of p73 in vitro

Given that Pirh2 promoted p73 ubiquitination in vivo, we sought to determine whether p73 was a direct substrate for Pirh2 in vitro. An in vitro ubiquitination assay was done (12, 25, 26) using GST-Pirh2 and His-p73α or His-p73β purified from Escherichia coli. The reactions were done in the presence of E1 and E2 (UbcH5b) and ubiquitin or the following ubiquitin mutants (KO: mutants in which the 7 lysine residues, K6, K11, K27, K29, K33, K48, and K63, were replaced with arginine; mutant in which only lysine K48 was replaced with arginine (K48R); and mutant in which only lysine K63 was replaced with arginine (K63R). The ubiquitination of purified p73 was analyzed by Western blot. Surprisingly, the UbK63R mutant markedly reduced the Pirh2-mediated ubiquitination of p73α and p73β when compared with UbK48R or wild-type Ub, suggesting that Pirh2-mediated p73 ubiquitination occurred primarily through the K63 chain of ubiquitin in vitro (Fig. 5A and B). To confirm these results, a series of ubiquitin mutants containing 1 lysine with the remaining 6 lysine residues mutated to arginine (K6, K11, K29, K48, and K63) were generated, purified from Escherichia coli, and used in the in vitro ubiquitination assay. In the presence of Pirh2 and p73, we detected high levels of Ub-Lys-63 and wild-type Ub conjugation, moderate levels of Ub-Lys-11 and Ub-Lys-29 conjugation, and low levels of Ub-Lys-6 and Ub-Lys-48 conjugation (Fig. 5C, top). The p73 immunoblots revealed differences in the pattern of ubiquitination between p73α and p73β; whereas Pirh2 primarily used Lys-63 to promote the ubiquitination of p73α, it used multiple lysine residue to mediate the ubiquitination of p73β (Fig. 5C, bottom). To eliminate the possible autoubiquitination of Pirh2, a coupled in vitro ubiquitination/IP was done (25). After the reactions proceeded for 2 hours, the mixtures were immunoprecipitated with the ER-15 antibody and analyzed by immunoblotting with the anti-Ub mAb to detect ubiquitinated p73 (Fig. 5D, top) or the ER-15 antibody to detect total p73 (Fig. 5D, bottom). Taken together, Pirh2 catalyzed K11-, K29-, K48-, and K63-linked Ub chains to promote p73 ubiquitination in vivo; in vitro, Pirh2 only usedLys-11, -29, and -63 Ub to mediate p73 ubiquitination, suggesting that additional factors may be involved.

Figure 5.
Figure 5.

Pirh2 is an E3 ligase for p73 in vitro. A and B, GST-Pirh2 was evaluated for its capacity to ubiquitinate purified His-p73α and His-p73β as indicated and analyzed by immunoblotting with anti-Ub to reveal ubiquitinated products (top) or with an antibody against p73 (ER-15) to reveal ubiquitinated p73 species. C, Pirh2 preferentially uses Ub with Lys residue at Lys-63, Lys-29, or Lys-11 for p73 ubiquitination in vitro. Affinity purified GST-Pirh2, His-p73α, or His-p73β were added to bacterial extracts containing recombinant E1 and E2 (UbcH5b) and wild-type Ub or ubiquitin mutants as indicated and analyzed by immunoblotting with anti-Ub to reveal ubiquitinated products (top) or anti-p73 (ER-15) to reveal ubiquitinated p73 species (bottom). D, similar to (C); samples after the ubiquitination reaction were immunoprecipitated with anti-p73 (ER-15) and analyzed by immunoblotting with anti-Ub (top) or anti-p73 (ER-15, top) as indicated. IB, immunoblotting.

To determine the physiologic consequence of the p73-Pirh2 interaction, we tested whether the ectopic expression of Pirh2 regulated the levels of endogenous p73 in HEK293 cells. We observed that overexpression of Pirh2 did not result in a reduction in the steady-state levels of endogenous p73 protein in HEK293 cells (data not shown). To further test whether Pirh2 negatively regulated p73 levels, Saos-2 cells were cotransfected with plasmids encoding Pirh2 or an empty vector and p73. Twenty-four hours after transfection, the cells were treated with CHX to inhibit de novo protein synthesis. Notably, in the presence of Pirh2, the half-life of p73 was not significantly altered when compared with its half-life in the presence of the empty vector, pcDNA3 (data not shown). These data were further confirmed by pulse chase with 35S-methionine/cysteine analysis of ectopically expressed p73 in the presence or absence of Pirh2 in HEK293 (data not shown). Together, the data indicated that Pirh2 is unable to directly regulate the stability of p73.

Pirh2 represses p73-dependent transcriptional activity

To gain insight into the functional consequences of the interaction of Pirh2 with p73, we examined the effect of Pirh2 or AIP4 expression on p73-mediated transcriptional activity. H1299 cells were cotransfected with a luciferase reporter construct (p21-luc) containing the p73 binding site from the p21WAF promoter and either p73 alone or p73 in combination with Pirh2 or AIP4. Both Pirh2 and AIP4 repressed p73-mediated transactivational activity (Fig. 6A). Unlike p53 (12), the Pirh2ΔRING mutant was unable to repress p73-dependent transcriptional activity, suggesting that the RING domain of Pirh2 was required inhibiting the p73-mediated transcriptional activity (Fig. 6A). Similarly, the AIP4 mutant (AIP4C830A) lost the ability to repress p73β transcriptional activity. These results indicate that the E3 ligase activity of Pirh2 is linked to the repression of p73 transactivational activity. To further assess the involvement of endogenous Pirh2 in the regulation of p73 ubiquitination, HCT p53−/− cells were pretreated with control siRNA, Pirh2 siRNA2, AIP4 siRNA, or a combination of Pirh2 siRNA2 and AIP4 siRNA. The cells were then transfected with the p21WAF luciferase reporter. As shown in Fig. 6B, p21WAF-luc activity was greatly increased in cells depleted of Pirh2 or AIP4 by siRNA. The transcriptional activity of p73 was further increased when both Pirh2 and AIP4 were depleted (Fig. 6B). These data are consistent with the results showing that p73 transcriptional activity was inhibited by overexpression of Pirh2. We also tested the binding of p73 to intron 3 of Pirh2 using a ChIP assay. As shown in Fig. 6C, similar to p53 (12), p73 bound to intron 3 of Pirh2 in p73+/+ MEFs in vivo but not in p73−/− MEFs.

Figure 6.
Figure 6.

Pirh2 represses p73-dependent transactivation. A, H1299 cells were cotransfected with a p21-Luc reporter plasmid and the p73 expression construct in combination with Pirh2, AIP4, or their mutants or an empty vector (pcDNA3.1). The luciferase activity was measured. Error bars indicate the SEM (n = 3). P < 0.01 (2-tailed Student t test). B, HCT116 p53−/− cells were treated with Pirh2-siRNA2, AIP4-siRNA, or control-siRNA for 30 hours. The cells were then transfected with the p21-Luc reporter expressing plasmid. The luciferase activity was measured. Error bars indicate the SEM (n = 3). P < 0.01 (2-tailed Student t test). C, ChIP assay to assess p73 DNA binding activity in p73−/− MEFs and parental p73+/+ MEFs. A polyclonal antibody against p73 (H-79) or control IgG was used. PCR analysis (using primers to intron 3 of Pirh2, the Pirh2 promoter, or intron 1 of Mdm2) is shown using input DNA (1/30 of ChIP) or DNA after ChIP. The amplification products ranged from 200 to 250 bp. D, H1299 clones stably expressing the empty vector (pcDNA3), Pirh2-1, Pirh2-2, and Pirh2ΔRING were subjected to semiquantitative RT-PCR to measure p73, Pirh2 and GAPDH mRNA levels (top two panels) and immunoblotting (IB, bottom) with the indicated antibodies to detect p73, Pirh2, or Pirh2ΔRING and actin. E, HCT116 p53−/− cells were transfected with the Pirh2-siRNA1, Pirh2-siRNA2, or control-siRNA as indicated. Semiquantitative RT-PCR was used to measure p73, Pirh2, and GAPDH mRNA levels. The amounts of endogenous p73, Pirh2, and actin proteins were determined by Western blot using p73-specific, Pirh2-specific, and actin-specific antibodies. F, H1299 cells were transfected with plasmids for the empty vector (pcDNA3), Flag-ΔNp73, or a combination of these with Myc-Pirh2 as indicated. The levels of ectopically expressed Pirh2 and ΔNp73 proteins were determined by immunoblotting with an anti-Flag antibody for ΔNp73 and an anti-Myc antibody for Pirh2. An antibody against β-actin was used as the loading control. G, MCF-7 cells were treated with control-siRNA, Pirh2-siRNA1, or Pirh2-siRNA2 for 40 hours. The levels of endogenous Pirh2, ΔNp73, and p53 proteins were determined by immunoblotting with Pirh2-specific, ΔNp73-specific (38C674, Abcam), and p53-specific (DO-1) antibodies. An antibody against β-actin was used as the loading control. H, human bladder carcinoma EJ cells were transfected with p73α alone or p73α in combination with Pirh2, Pirh2ΔRING, or an empty vector (pcDNA3) as indicated, and the cell-cycle profile was determined by propidium iodide staining and flow cytometry. The results represent the average of triplicate experiments.

To determine the mechanisms of Pirh2 suppression of p73 transcriptional activity, reverse transcriptase PCR (RT-PCR) was done to examine p73 transcript levels in H1299 clones that stably expressed Pirh2, Pirh2ΔRING, or an empty vector. As shown in Fig. 6D (top), p73 transcript levels were decreased in the two H1299 clones stably expressing Pirh2 but not in the empty vector or Pirh2ΔRING expressing cells. This reduction was highly relative to the overexpression of Pirh2 and was dependent on the RING domain of Pirh2. Similar data were also obtained in Saos-2 cells that stably expressed Pirh2 (data not shown), indicating that the Pirh2 repression of p73 transcript levels was not restricted to one cell line and was dependent on the Pirh2 E3 ligase activity. The p73 protein levels were consistently unaffected by ectopic expression of Pirh2 (Fig. 6D, bottom). To determine whether endogenous Pirh2 was critical in regulating p73 transcript levels, siRNA experiments were conducted. We observed that Pirh2-siRNA1 and Pirh2-siRNA2 effectively knocked down the levels of Pirh2 RNA and protein in HCT116 p53−/− cells (Fig. 6E). The p73 transcript levels increased, but the p73 protein levels were not affected. Together, our findings indicated that Pirh2 represses p73 transcriptional activity possibly by directly inhibiting p73 transcripts and is dependent on Pirh2 E3 ligase activity.

Because wild-type p73 can be negatively regulated by delta Np73 (27–29), we tested whether delta Np73 levels were affected by the presence or absence of Pirh2. H1299 cells were transfected with delta Np73 alone or delta Np73 in combination with Pirh2. As shown in Fig. 6F, ectopic expression of Pirh2 did not affect delta Np73 protein levels. We consistently observed that delta Np73 protein levels did not change when cells were depleted of Pirh2 using siRNA in MCF-7 cells (Fig. 6G). In contrast, p53 protein levels increased when cells were depleted of Pirh2 (Fig. 6G). Together, the data indicate that p73 transcriptional repression is differently regulated by Pirh2 and delta Np73.

In addition to suppression of p73 transcriptional activity, we examined whether Pirh2 inhibited p73-dependent apoptosis. Transient expression experiments and fluorescence-activated cell sorting analysis (using Annexin V staining) were done to determine whether Pirh2 expression could rescue cells from p73-dependent cell death. The expression of p73 alone resulted in apoptosis; however, apoptosis could not be prevented by coexpression of Pirh2 (data not shown). In addition, in long-term colony assays, Pirh2 did not inhibit p73-dependent cell death (data not shown). Cell-cycle arrest mediated by p73 is important for its tumor suppressor function. To determine whether Pirh2 inhibited p73-induced G1 arrest, human bladder carcinoma EJ cells, which lack functional p53 (30, 31), were transfected with p73α alone or p73α in combination with Pirh2 or Pirh2ΔRING and subjected to cell-cycle analysis by propidium iodide staining and flow cytometry (12). We observed that p73-induced G1 arrest was partially prevented by overexpression of Pirh2 (Fig. 6H); however, Pirh2ΔRING was unable to prevent p73-induced G1 arrest (Fig. 6H), suggesting that the E3 ligase activity of Pirh2 was required to inhibit p73-dependent cell-cycle arrest. Our findings indicate that p73 repression by Pirh2 is required for p73-dependent transcriptional activity and G1 arrest but not for apoptosis. The data further indicated that p73-dependent transcriptional activity, G1 cell-cycle arrest, and apoptosis are regulated by different mechanisms.

Discussion

The p73 protein has been identified as a homolog of the tumor suppressor protein p53 and is capable of inducing apoptosis or cell-cycle arrest. Here, we report that Pirh2 physically interacts with p73 and inhibits p73-dependent transcriptional activity by promoting its ubiquitination. Our findings suggest that the regulation of p73 transcriptional activity and degradation can be controlled by different mechanisms.

Intriguingly, Pirh2 catalyzed K11-, K29-, K48- and K63-linked Ub chains to ubiquitinate p73 in vivo and markedly used K63-linked chains to promote p73 ubiquitination in vitro. Substrates with 4 or more Ub moieties, linked via Lys-48, Lys-29, or Lys-11, have been reported to be targeted for degradation by the 26S proteasome (32, 33). Lys-63-linked chains seem to be used primarily for nonproteasome-dependent regulation of processes, such as DNA repair, endocytosis, transcriptional repression, and chromatin remodeling (34, 35). The biological importance of K48-linked polyUb chains has been shown by the lethality of the K48R mutation in the yeast, Saccharomyces cerevisiae (36). In contrast, the K63R mutation of Ub in yeast degrades short-lived proteins and abnormal proteins, which are the canonical substrates of the Ub-proteasome system at a normal rate (37). Recent studies have suggested that K63-linked chains also support proteasomal degradation (38, 39). Rad6 has been reported to be an E2 that normally supports Lys-48 chain-dependent degradation in yeast, but Rad6 also supports Lys-63 chain-mediated degradation, suggesting that linkage specificity may depend on either the target proteins or the E3 used for conjugation (40). As shown by Parkin (41), Pirh2 may act as a dual E3 Ub ligase that uses K48-linked chains to promote p53 degradation and K63-linked chains to repress p73 transactivation. The possibility that Pirh2 uses different E2 proteins through distinct mechanisms exists.

Because p73 deletion or point mutants that lack transactivational activity are stable compared with wild-type p73, Wu and colleagues (2004) proposed that p73 transcriptional activity is linked to its degradation (42). We observed that Pirh2 repressed p73-dependent transcriptional activity by promoting p73 ubiquitination without targeting its degradation. Depletion of Pirh2 by siRNA restored p73 transactivational function in p53 null cells. Moreover, we found that Pirh2 repressed p73 transcriptional activity by directly inhibiting p73 transcripts, and p73 repression by Pirh2 was required for p73-dependent transcriptional activity and G1 arrest but not for apoptosis. Our results provide the molecular mechanism for understanding how Pirh2 negatively regulates p73 function. Recently, Jung and colleagues reported that Pirh2 promoted p73 ubiquitination and degradation in RKO and MCF7 cells (43), which suggests that the regulation of p73 protein stability by Pirh2 seems to be dependent on cell type. Notably, MDM2 did not promote p73 degradation in most cell lines (44, 45). Kubo and colleagues reported that MDM2 mediated p73 degradation through the interaction with Itch in HeLa cells (46). Therefore, it will be of interest to further investigate whether additional factors may be involved in p73 degradation mediated by Pirh2.

In summary, our findings indicate that p73-dependent transcriptional activity is regulated by ubiquitination. In addition, our data reveal that p73-mediated transactivation and apoptosis are controlled by different mechanisms.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Grant Support

This work was supported by grants from the Alberta Heritage Foundation for Medical Research (AHFMR), Women and Children's Health Research Institute (WCHRI), and Canadian Institutes of Health Research (CIHR) to R.P. Leng. R.P. Leng is an AHFMR scholar.

The costs of publications of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Acknowledgments

The authors thank Drs. T. Pawson for providing us with Myc-AIP4 and Myc-AIP4 mutant (C830A), W. Gu for the His-Ubiquitin (wt) and His-Ubiquitin-KO plasmids, and X. Chen for ΔNp73 expressing plasmid.

  • Received April 7, 2011.
  • Revision received September 23, 2011.
  • Accepted October 2, 2011.

References

  1. 1.↵
    1. Yang A,
    2. McKeon F
    . p63 and p73: p53 mimics, menace and more. Nat Rev Mol Cell Biol 2000;1:199–07.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Yang A,
    2. Kaghad M,
    3. Caput D,
    4. McKeon F
    . On the shoulders of giants: p63, p73 and the rise of p53. Trends Genet 2002;18:90–5.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Irwin MS,
    2. Kaelin WG
    . p53 family update: p73 and p63 develop their own identities. Cell Growth Differ 2001;12:337–49.
    OpenUrlFREE Full Text
  4. 4.↵
    1. Levrero M,
    2. De Laurenzi V,
    3. Costanzo A,
    4. Gong J,
    5. Wang JY,
    6. Melino G
    . The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J Cell Sci 2000;113:1661–70.
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. Kaghad M,
    2. Bonnet H,
    3. Yang A,
    4. Creancier L,
    5. Biscan JC,
    6. Valent A,
    7. et al.
    Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 1997;90:809–19.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Yang A,
    2. Walker N,
    3. Bronson R,
    4. Kaghad M,
    5. Oosterwegel M,
    6. Bonnin J,
    7. et al.
    p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature 2000;404:99–03.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Ahomadegbe JC,
    2. Tourpin S,
    3. Kaghad M,
    4. Zelek L,
    5. Vayssade M,
    6. Mathieu MC,
    7. et al.
    Loss of heterozygosity, allele silencing and decreased expression of p73 gene in breast cancers: Prevalence of alterations in inflammatory breast cancers. Oncogene 2000;19:5413–18.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Puig P,
    2. Capodieci P,
    3. Drobnjak M,
    4. Verbel D,
    5. Prives C,
    6. Cordon-Cardo C,
    7. et al.
    p73 expression in human normal and tumor tissues: loss of p73α expression is associated with tumor progression in bladder cancer. Clin Cancer Res 2003;9:5642–51.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Park HR,
    2. Kim YW,
    3. Park JH,
    4. Maeng YH,
    5. Nojima T,
    6. Hashimoto H,
    7. et al.
    Low expression of p63 and p73 in osteosarcoma. Tumori 2003;90:239–43.
    OpenUrl
  10. 10.↵
    1. Flores ER,
    2. Sengupta S,
    3. Miller JB,
    4. Newman JJ,
    5. Bronson R,
    6. Crowley D,
    7. et al.
    Tumor predisposition in mice mutant for p63 and p73: Evidence for broader tumor suppressor functions for the p53 family. Cancer Cell 2005;7:363–72.
    OpenUrlCrossRefPubMed
  11. 11.↵
    1. Rossi M,
    2. Laurenzi VD,
    3. Munarriz E,
    4. Green DR,
    5. Liu Y,
    6. Vousden KH,
    7. et al.
    The ubiquitin-protein ligase Itch regulates p73 stability. EMBO J 2005;24:836–48.
    OpenUrlCrossRefPubMed
  12. 12.↵
    1. Leng RP,
    2. Lin Y,
    3. Ma W,
    4. Wu H,
    5. Lemmers B,
    6. Chung S,
    7. et al.
    Pirh2, a p53 induced ubiquitin-protein ligase, promotes p53 degradation. Cell 2003;112:779–91.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Dornan D,
    2. Wertz I,
    3. Shimizu H,
    4. Arnott D,
    5. Frantz GD,
    6. Dowd P,
    7. et al.
    The ubiquitin ligase COP1 is a critical negative regulator of p53. Nature 2004;429:86–92.
    OpenUrlCrossRefPubMed
  14. 14.↵
    1. Duan S,
    2. Yao Z,
    3. Hou D,
    4. Wu Z,
    5. Zhu WG,
    6. Wu M
    . Phosphorylation of Pirh2 by calmodulin-dependent kinase II impairs its ability to ubiquitinate p53. EMBO J 2007;26:3062–74.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Sheng Y,
    2. Laister RC,
    3. Lemak A,
    4. Wu B,
    5. Tai E,
    6. Duan S,
    7. et al.
    Molecular basis of Pirh2-mediated p53 ubiquitylation. Nat Struct Mol Biol 2008;15:1334–42.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Duan W,
    2. Gao L,
    3. Druhan LJ,
    4. Zhu WG,
    5. Morrison C,
    6. Otterson GA,
    7. et al.
    Expression of Pirh2, a newly identified ubiquitin protein ligase, in lung cancer. J Natl Cancer Inst 2004;96:1718–21.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    1. Duan W,
    2. Gao L,
    3. Wu X,
    4. Zhang Y,
    5. Otterson GA,
    6. Villalona-Calero MA
    . Differential response between the p53 ubiquitin-protein ligases Pirh2 and Mdm2 following DNA damage in human cancer cells. Exp Cell Res 2006;312:3370–78.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Koepp DM,
    2. Harper JW,
    3. Elledge SJ
    . How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell 1999;97:431–34.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Ang XL,
    2. Harper WJ
    . SCF-mediated protein degradation and cell cycle control. Oncogene 2005;24:2860–70.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Beitel LK,
    2. Elhaji YA,
    3. Lumbroso R,
    4. Wing SS,
    5. Panet-Raymond V,
    6. Gottlieb B,
    7. et al.
    Cloning and characterization of an androgen receptor N-terminal-interacting protein with ubiquitin-protein ligase activity. J Mol Endocrinol 2002;29:41–60.
    OpenUrlAbstract
  21. 21.↵
    1. Logan IR,
    2. Sapountzi V,
    3. Gaughan L,
    4. Neal DE,
    5. Robson CN
    . Control of human PIRH2 protein stability: involvement of TIP60 and the proteosome. J Biol Chem 2004;279:11696–04.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Zhang L,
    2. Li J,
    3. Wang C,
    4. Ma Y,
    5. Huo K
    . A new human gene hNTKL-BP1 interacts with hPirh2. Biochem Biophys Res Commun 2005;330:293–97.
    OpenUrlCrossRefPubMed
  23. 23.↵
    1. Logan IR,
    2. Gaughan L,
    3. McCracken SR,
    4. Sapountzi V,
    5. Leung HY,
    6. Robson CN
    . Human PIRH2 enhances androgen receptor signaling through inhibition of histone deacetylase 1 and is overexpressed in prostate cancer. Mol Cell Biol 2006;26:6502–10.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. Hattori T,
    2. Isobe T,
    3. Abe K,
    4. Kikuchi H,
    5. Kitagawa K,
    6. Oda T,
    7. et al.
    Pirh2 promotes ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor p27Kip1. Cancer Res 2007;67:10789–95.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Wu H,
    2. Pomeroy SL,
    3. Ferreira M,
    4. Teider N,
    5. Mariani J,
    6. Nakayama KI,
    7. et al.
    UBE4B promotes Hdm2-mediated degradation of the tumor suppressor p53. Nat Med 2011;17:347–56.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Lorick KL,
    2. Jensen JP,
    3. Fang S,
    4. Ong AM,
    5. Hatakeyama S,
    6. Weissman AM
    . RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc Natl Acad Sci USA 1999;96:11364–9.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    1. Grob TJ,
    2. Novak U,
    3. Maisse C,
    4. Barcaroli D,
    5. Lüthi AU,
    6. Pirnia F,
    7. et al.
    Human delta Np73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 2001;8:1213–23.
    OpenUrlCrossRefPubMed
  28. 28.↵
    1. Buhlmann S,
    2. Pützer BM
    . DNp73 a matter of cancer: Mechanisms and clinical implications. Biochimica et Biophysica Acta 2008;1785:207–16.
    OpenUrlPubMed
  29. 29.↵
    1. DeYoung MP,
    2. Ellisen LW
    . p63 and p73 in human cancer: defining the network. Oncogene 2007;26:5169–83.
    OpenUrlCrossRefPubMed
  30. 30.↵
    1. Sharma S,
    2. Schwarte-Waldhoff I,
    3. Oberhuber H,
    4. Schafer R
    . Functional interaction of wild-type and mutant p53 transfected into human tumor cell lines carrying activated ras genes. Cell Growth Differ 1993;4:861–9.
    OpenUrlAbstract
  31. 31.↵
    1. Fang L,
    2. Lee SW,
    3. Aaronson SA
    . Comparative analysis of p73 and p53 regulation and effector functions. J Cell Biol 1999;147:823–30.
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    1. Hershko A,
    2. Ciechanover A
    . The ubiquitin system for protein degradation. Annu Rev Biochem 1992;61:761–07.
    OpenUrlCrossRefPubMed
  33. 33.↵
    1. Pickart CM
    . Ubiquitin in chains. TIBS 2000;25:544–48.
    OpenUrlPubMed
  34. 34.↵
    1. Hicke L
    . Protein regulation by monoubiquitin. Nat Rev Mol Cell Biol 2001;2:195–01.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Pickart CM,
    2. Fushman D
    . Polyubiquitin chains: polymeric protein signals. Curr Opin Chem Biol 2004;8:610–6.
    OpenUrlCrossRefPubMed
  36. 36.↵
    1. Finley D,
    2. Sadis S,
    3. Monia BP,
    4. Boucher P,
    5. Ecker DJ,
    6. Crooke ST,
    7. et al.
    Inhibition of proteolysis and cell cycle progression in a multiubiquitination-deficient yeast mutant. Mol Cell Biol 1994;14:5501–09.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Spence J,
    2. Sadis S,
    3. Hass AL,
    4. Finley D
    . A ubiquitin mutant with specific defects in DNA repair and multiubiquitination. Mol Cell Biol 1995;15:1265–73.
    OpenUrlAbstract/FREE Full Text
  38. 38.↵
    1. Kim HT,
    2. Kim KP,
    3. Lledias F,
    4. Kisselev AF,
    5. Scaglione KM,
    6. Skowyra D,
    7. et al.
    Certain pairs of ubiquitin-conjugating enzymes (E2 s) and ubiquitin- protein ligases (E3 s) synthesize nondegradable forked ubiquitin chains containing all possible isopeptide linkages. J Biol Chem 2007;282:17375–86.
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    1. Saeki Y,
    2. Kudo T,
    3. Sone T,
    4. Kikuchi Y,
    5. Yokosawa H,
    6. Toh-e A,
    7. et al.
    Lysine 63-linked polyubiquitin chain may serve as a targeting signal for the 26S proteasome. EMBO J 2009;28:359–71.
    OpenUrlCrossRefPubMed
  40. 40.↵
    1. Baboshina OV,
    2. Haas AL
    . Novel multiubiquitin chain linkages catalyzed by the conjugating enzymes E2 and RAD6 are recognized by 26 S proteasome subunit 5. J Biol Chem 1996;271:2823–31.
    OpenUrlAbstract/FREE Full Text
  41. 41.↵
    1. Doss-Pepe EW,
    2. Chen L,
    3. Madura K
    . α-Synuclein and Parkin contribute to the assembly of ubiquitin Lysine 63-linked multiubiquitin chains. J Biol Chem 2005;280:16619–24.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. Wu L,
    2. Zhu H,
    3. Nie L,
    4. Maki CG
    . A link between p73 transcriptional activity and p73 degradation. Oncogene 2004;23:4032–6.
    OpenUrlCrossRefPubMed
  43. 43.↵
    1. Jung YS,
    2. Qian Y,
    3. Chen X
    . The p73 tumor suppressor is targeted by Pirh2 RING finger E3 ubiquitin ligase for the proteasome-dependent degradation. J Biol Chem 2011;286:35388–95.
    OpenUrlAbstract/FREE Full Text
  44. 44.↵
    1. Balint E,
    2. Bates S,
    3. Vousden KH
    . Mdm2 binds p73α without targeting degradation. Oncogene 1999;18:3923–9.
    OpenUrlCrossRefPubMed
  45. 45.↵
    1. Zeng X,
    2. Chen L,
    3. Jost CA,
    4. Maya R,
    5. Keller D,
    6. Wang X,
    7. et al.
    MDM2 suppresses p73 function without promoting p73 degradation. Mol Cell Biol 1999;19:3257–66.
    OpenUrlAbstract/FREE Full Text
  46. 46.↵
    1. Kubo N,
    2. Okoshi R,
    3. Nakashima K,
    4. Shimozato O,
    5. Nakagawara A,
    6. Ozaki T
    . MDM2 promotes the proteasomal degradation of p73 through the interaction with Itch in HeLa cells. Biochem Biophys Res Commun 2010;403:405–11.
    OpenUrlPubMed
View Abstract
Back to top
Molecular Cancer Research: 9 (12)
December 2011
Volume 9, Issue 12

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Email Article
Citation Tools
Pirh2, a Ubiquitin E3 Ligase, Inhibits p73 Transcriptional Activity by Promoting Its Ubiquitination
Hong Wu, Zeinab Rami Abou, Elsa R. Flores and Roger P. Leng
Mol Cancer Res December 1 2011 (9) (12) 1780-1790; DOI: 10.1158/1541-7786.MCR-11-0157
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Advertisement