Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • Log out
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Rapid Impact Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Metabolism Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Spotlight on Genomic Analysis of Rare and Understudied Cancers
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Molecular Cancer Research
Molecular Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Rapid Impact Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Metabolism Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Spotlight on Genomic Analysis of Rare and Understudied Cancers
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

DNA Damage and Cellular Stress Responses

Acquired Resistance to Combination Treatment with Temozolomide and ABT-888 Is Mediated by Both Base Excision Repair and Homologous Recombination DNA Repair Pathways

Xuesong Liu, Edward K. Han, Mark Anderson, Yan Shi, Dimitri Semizarov, Gang Wang, Thomas McGonigal, Lisa Roberts, Loren Lasko, Joann Palma, Gui-dong Zhu, Thomas Penning, Saul Rosenberg, Vincent L. Giranda, Yan Luo, Joel Leverson, Eric F. Johnson and Alexander R. Shoemaker
Xuesong Liu
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Edward K. Han
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mark Anderson
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yan Shi
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Dimitri Semizarov
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Gang Wang
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Thomas McGonigal
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lisa Roberts
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Loren Lasko
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joann Palma
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Gui-dong Zhu
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Thomas Penning
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Saul Rosenberg
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Vincent L. Giranda
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yan Luo
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joel Leverson
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Eric F. Johnson
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Alexander R. Shoemaker
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1158/1541-7786.MCR-09-0299 Published October 2009
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Many established cancer therapies involve DNA-damaging chemotherapy or radiotherapy. Gain of DNA repair capacity of the tumor represents a common mechanism used by cancer cells to survive DNA-damaging therapy. Poly(ADP-ribose) polymerase-1 (PARP-1) is a nuclear enzyme that is activated by DNA damage and plays a critical role in base excision repair. Inhibition of PARP represents an attractive approach for the treatment of cancer. Previously, we have described the discovery and characterization of a potent PARP inhibitor, ABT-888. ABT-888 potentiates the activity of DNA-damaging agents such as temozolomide (TMZ) in a variety of preclinical models. We report here the generation of HCT116 cells resistant to treatment with TMZ and ABT-888 (HCT116R cells). HCT116R cells exhibit decreased H2AX phosphorylation in response to treatment with TMZ and ABT-888 relative to parental HCT116 cells. Microarray and Western blot studies indicate that HCT116R cells have decreased PARP-1 and elevated Rad51 expression levels. HCT116R cells are dependent on Rad51 for proliferation and survival, as shown by inhibition of proliferation and induction of apoptosis upon treatment with Rad51 small interfering RNA. In addition, HCT116R cells are more resistant to radiation than the parental HCT116 cells. Our study suggests that cancer cells upregulate the homologous recombination DNA repair pathway to compensate for the loss of base excision repair, which may account for the observed resistance to treatment with TMZ and ABT-888. (Mol Cancer Res 2009;7(10):1686–92)

  • ABT-888
  • PARP
  • TMZ
  • Rad51
  • BER

Introduction

Poly(ADP-ribose) polymerase-1 (PARP-1) is the founding member of a family of proteins that share a catalytic PARP homology domain and are characterized by their ability to poly(ADP-ribosyl)ate their protein substrates (1-3). Of the 18 PARP family members identified to date (1, 2), PARP-1 and PARP-2 are unique in stimulating catalytic activity in response to DNA damage (4). The activation of PARP-1 and PARP-2 is an immediate eukaryotic cellular response to DNA damage induced by a variety of stimuli including ionizing radiation, alkylating agents, and oxidants (2). Activated PARP-1 and PARP-2 bind to DNA strand breaks, and covalently attach poly(ADP-ribose), or PAR, to nuclear proteins including PARP-1 itself, histones, and transcription factors (1). The enzymatic product of PARP is generated from its substrate β-NAD+ and consists of linear and branched ADP-ribose units of variable size (5).

Most established cancer therapy regimens involve the utilization of DNA-damaging chemotherapy and/or radiotherapy. Upregulation of DNA repair capacity represents a common mechanism used by cancer cells to survive such therapy. Inhibiting DNA repair systems increases the ability of DNA-damaging agents to eliminate cancer cells and represents an attractive approach for cancer therapy (3). Both PARP-1 and PARP-2 are essential for the repair of single-strand DNA breaks (SSB) through base excision repair (BER; refs. 1, 6, 7); thus, inhibition of PARP-1/PARP-2 will enhance the efficacy of cancer therapeutics that cause DNA damage requiring BER-mediated repair (6, 8). In addition, PARP-1 is overexpressed in a variety of human tumors, including malignant lymphoma (9), hepatocellular carcinomas (10), cervical cancer (11), and non–Hodgkin lymphoma (12).

Mammalian cells have multiple ways to repair damaged DNA. DNA repair pathways can be divided into those that respond to SSBs and those that respond to double-strand breaks (DSB). SSB repair pathways include BER, mismatch repair, and nucleotide excision repair. DSB repair pathways include nonhomologous end joining (NHEJ), and homologous recombination (HR). In response to DSB, the Mre11/Rad50/NBS1 (MRN) complex is recruited to the DNA damage site, triggering the activation of ATM (13). Activated ATM phosphorylates Ser139 on the carboxyl tail of H2AX. In addition to ATM, ATR and DNA-PKcs are also able to phosphorylate H2AX (14, 15). Phosphorylated H2AX (γH2AX) plays an important role in the recruitment of DNA repair proteins such as BRCA1, MDC1, and 53BP1, followed by recruitment of Rad51 (15-19). Rad51 is a central DNA recombinase that catalyzes homologous pairing and strand exchange in the HR pathway (20). It is well recognized that γH2AX levels correlate with the extent of DNA DSBs (21, 22).

Temozolomide (TMZ) is a monofunctional DNA-alkylating agent that is used to treat malignant glioma and melanoma (23). TMZ forms methyl adducts in DNA at N7 guanine, O6 guanine, and N3 adenine. The O6 methyl guanine DNA lesion can be repaired by O6-methylguanine-DNA methyltransferase, whereas the methylpurines (N7-MeG and N3-MeA) are repaired by the BER system facilitated by PARP-1 and PARP-2 (24, 25). Inhibition of PARP potentiates the activity of DNA-damaging agents such as TMZ in cancer cells in vitro and in preclinical tumor models in vivo (6, 23). Interestingly, PARP inhibition has been shown to be synthetically lethal in the context of cancer cells defective in BRCA1 and BRCA2 function (26, 27). In fact, a deficiency of other proteins in the HR DNA repair pathway also sensitizes cancer cells to PARP inhibition (28). This effect is most likely due to the fact that PARP inhibition leads to the persistence of endogenous SSBs that are converted to DSBs during DNA replication. The failure to efficiently repair these DSBs in the absence of functional HR leads to cell lethality.

Previously, we described the discovery and characterization of a potent PARP inhibitor, ABT-888 (29). ABT-888 is a potent inhibitor of both PARP-1 and PARP-2 and is currently being examined in multiple phase I/II clinical trials. ABT-888 potentiates the activity of multiple DNA-damaging agents including TMZ in a variety of preclinical models. We report here the generation of HCT116 cells resistant to TMZ/ABT-888 (HCT116R cells). HCT116R cells exhibit decreased γH2AX levels compared with parental HCT116 cells in response to TMZ/ABT-888. Microarray and Western blot studies indicate that HCT116R cells have decreased levels of PARP-1 and elevated levels of Rad51. Knockdown of Rad51 by small interfering RNA (siRNA) indicates that HCT116R cells are dependent on Rad51 for proliferation and survival. In addition, HCT116R cells are also more resistant to treatment with radiation than parental HCT116 cells. Our study suggests that resistance to treatment with TMZ and PARP inhibitors arises from defective BER and enhanced HR repair capacity.

Results

Characterization of HCT116 Cells Resistant to TMZ and ABT-888 Combination Treatment

We have described previously the in vivo activity of ABT-888 in combination with TMZ in a variety of preclinical tumor models (29). In order to study potential molecular mechanisms of resistance to treatment with TMZ/ABT-888, we generated HCT116R cells by incubating parental HCT116 cells with TMZ/ABT-888 for an extended period for selection of resistant clones. Three clones of HCT116R cells, designated HCT116-C1, HCT116-C2, and HCT116-C3, were isolated. As shown in Fig. 1A, ABT-888 potentiated the effect of TMZ in parental HCT116 cells, consistent with our previous data (23). However, the ability of ABT-888 to enhance the cell-killing effects of TMZ was significantly attenuated in all three clones (Fig. 1B, C, and D).

FIGURE 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 1.

Characterization of HCT116R cells. HCT116R cells were generated as described in Materials and Methods. Cells were treated with the indicated concentration of TMZ in the absence (▴) or presence of 5 μmol/L of ABT-888 (▪) for 5 d. The AlamarBlue cell proliferation assay was used to assess cell viability. Parental HCT116 (A), HCT116-C1 (B), HCT116-C2 (C), and HCT116-C3 (D) cells.

Rad51 Is Upregulated in HCT116R Cells

In order to investigate potential mechanisms for resistance to treatment with TMZ/ABT-888, we examined differences in gene expression pattern between HCT116 and HCT116R cells. Significant changes in gene expression common to all resistant cells compared with the sensitive parental cells could be grouped into several major functional categories including DNA damage repair/response, cell cycle regulation, transcription, signaling, and catalytic processes (Supplemental Fig. S1). The Database for Annotation, Visualization, and Integrated Discovery (DAVID) for Gene Ontologies was used to evaluate these functional classes (30). The analysis indicated that changes of gene expression in DNA damage repair/response and cell cycle regulation were the most significant based on P value (data not shown). Given the logical association of potential for changes in gene expression in DNA repair pathways to influence sensitivity to TMZ/ABT-888, we examined this in more detail. The microarray data indicated that all of the HCT116R clones have decreased levels of PARP-1 mRNA and increased levels of mRNA encoding various HR proteins including Rad51, FANCA, FANCG, BLM, BRCA1, and BRCA2 (Table 1). Western blot analysis confirmed that HCT116R cells had decreased levels of PARP-1 and elevated levels of Rad51, BLM, and BRCA2 (Fig. 2). Among these changes, the decrease in PARP1 and increase in Rad51 are the most consistently observed in all resistant clones (Fig. 2).

View this table:
  • View inline
  • View popup
Table 1.

Alteration of DNA Damage Repair/Response Genes in HCT116R Cells

FIGURE 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 2.

Western blot analysis of DNA repair proteins in HCT116 and HCT116R cells. Cells were harvested and the cell lysate (50 μg total protein) was subjected to Western blot analysis for the indicated proteins as described in Materials and Methods.

HCT116R Cells Have Increased Ability to Repair DSB

TMZ is a monofunctional DNA-alkylating agent that induces SSBs in mammalian cells. Previously, we showed that ABT-888 enhances the toxicity of TMZ by converting TMZ-induced SSBs to DSBs (23). The fact that HCT116R cells have elevated levels of Rad51 indicates that HCT116R cells may have elevated ability to repair TMZ/ABT-888–induced DSB through the HR repair pathway. In order to test this, we conducted γH2AX analysis because it is well established that increased levels of the γH2AX correlated with increases in DSB accumulation (23). The cells were analyzed for γH2AX levels 1 hour (Fig. 3A) and 6 hours (Fig. 3B) after combination treatment with TMZ and ABT-888. Consistent with our previous data, TMZ/ABT-888 induced a strong γH2AX signal with 32% and 31% cells positive for γH2AX staining in parental HCT116 cells 1 and 6 hours posttreatment, respectively (Fig. 3), whereas ABT-888 alone did not elicit a significant γH2AX response (Fig. 3). In HCT116R cells, ∼10% cells were γH2AX-positive 1 hour posttreatment with TMZ alone or with TMZ plus ABT-888 (Fig. 3A). However, the γH2AX levels in HCT116R cells were reduced to background levels 6 hours posttreatment with TMZ alone or TMZ plus ABT-888 (Fig. 3B).

FIGURE 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 3.

HCT116R cells exhibit diminished γH2AX induction in response to TMZ/ABT-888. Cells were pretreated with 5 μmol/L of ABT-888 for 30 min, then 1 mmol/L of TMZ and 5 μmol/L of ABT-888 for 30 min, followed by incubation with ABT-888 for 1 h (A) or 6 h (B) to allow DNA repair. The γH2AX assay was carried out as described in Materials and Methods.

HCT116R Cells Depend on Rad51 for Proliferation and Survival

In order to determine the role of Rad51 in HCT116R cells, we used RNA interference to selectively knockdown Rad51 in parental HCT116 and HCT116-C3 cells. As shown in Fig. 4A and B, Rad51 siRNA reduced Rad51 protein levels in both HCT116-C3 and HCT116 cells to a similar extent. Knockdown of Rad51 led to a 79% inhibition of proliferation in HCT116-C3 cells, but only a 24% decrease in proliferation in parental HCT116 cells (Fig. 4C). Moreover, Rad51 siRNA also induced significant activation of caspase-3/7 in HCT116-C3 cells, but had no effect on caspase activation in parental HCT116 cells (Fig. 4D).

FIGURE 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 4.

Rad51 siRNA inhibits cell proliferation and induces apoptosis in HCT116R cells. Cells were transfected with control siRNA or Rad51 siRNAs as described in Materials and Methods. Ninety-six hours later, cells were harvested. Half of the cells were used for Western blot analyses with anti-Rad51 and anti-actin antibodies (A and B), the other half of the cells were used for viability and caspase-3/7 activity assays as described in Materials and Methods (C and D).

HCT116R Cells Are More Resistant to Radiation than Parental HCT116 Cells

Rad51 is known to be a key regulator of cellular response to radiation owing to its critical function in HR (31, 32). In order to examine the functional significance of elevated Rad51 expression in HCT116R cells, we examined the response of these cells to radiation treatment. The HCT116-C3 cells are significantly more resistant to treatment with X-ray radiation than parental HCT116 cells. Following treatment with 10 Gy of radiation, 27% of the HCT116-C3 cells remained viable whereas only 2% viability was observed for parental HCT116 cells (Fig. 5).

FIGURE 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 5.

HCT116R cells are more resistant to radiation compared with HCT116 cells. On day 1, 1 × 106 cells were treated with the indicated dose of radiation. On day 2, 200 cells were plated into each well of six-well plates in triplicate. Colony formation assays were carried out as described in Materials and Methods.

HCT116R Cells Fail to Generate PAR in Response to DNA Damage

As shown in Fig. 2, PARP-1 levels were also greatly reduced in all the resistant clones relative to the parental cells. In order to confirm functional inactivation of PARP-1, we examined the levels of PAR, the product of PARP-1, in HCT116 and HCT116-C3 cells with hydrogen peroxide in the presence or absence of ABT-888 (29). As shown in Fig. 6, HCT116 cells had high basal levels of PAR. H2O2 further enhanced PAR formation, whereas ABT-888 blocked the process (Fig. 6). However, HCT116-C3 cells, which had inherently low levels of PAR and H2O2, failed to induce significant PAR formation (Fig. 6). These results show that HCT116R cells are also functionally defective in BER.

FIGURE 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 6.

H2O2 induced PAR formation in parental HCT116 cells but not HCT116R cells. Cells were treated with DMSO or 5 μmol/L of ABT-888 for 30 min prior to cotreatment with 1 mmol/L of H2O2 with either DMSO or 5 μmol/L of ABT-888 for another 10 min. Then, the cells were harvested and subjected to Western blot analysis for PAR, PARP1, and actin, respectively.

Discussion

ABT-888 is a potent PARP inhibitor that is currently in multiple phase I/II clinical trials, including studies examining combination with TMZ. In order to examine the potential mechanisms of drug resistance that may occur in response to treatment with TMZ/ABT-888 chemotherapy, we generated resistant cells by in vitro selection. Our data indicate that HCT116R cells become resistant to TMZ/ABT-888 through enhanced HR capacity and defects in the BER pathway. DSBs in the mammalian genome are repaired through NHEJ and HR. DNA-PKcs, Ku70, and Ku80 are critical components of NHEJ pathway, whereas proteins such as BRCA1/2, MDC1, 53BP1, and Rad51 are critical components of the HR pathway. The HR pathway is mainly active in S phase, whereas NHEJ is active through all phases of the cell cycle (33). HCT116R cells have elevated levels of Rad51, but unchanged levels of DNA-PKcs and Ku70. Rad51 is a central DNA recombinase that catalyzes homologous pairing and strand exchange in the HR pathway (20), whereas other proteins such as BRCA1/2 facilitate the assembly of Rad51 foci at the DSB site (34-36). Previously, we have shown that ABT-888 potentiates the ability of TMZ to kill cancer cells by converting TMZ-induced SSBs to DSBs, as shown by γH2AX assay and neutral comet assay (23). HCT116R cells are able to repair DSBs via the HR pathway more efficiently, as shown by the fact that HCT116R cells exhibited elevated levels of Rad51 (Fig. 2), decreased levels of γH2AX in response to TMZ/ABT-888 (Fig. 3), and resistance to radiation treatment relative to HCT116 parental cells (Fig. 5). In addition, knockdown of Rad51 by siRNA showed that HCT116R cells are more dependent on Rad51 for growth and survival relative to parental HCT116 cells (Fig. 4). Rad51 is overexpressed in a variety of tumor cell lines through transcriptional regulation, contributing to both tumorigenesis and resistance to DNA-damaging radiation and chemotherapy (32). It is also interesting to note that HCT116R cells are not resistant to treatment with TMZ alone. The expression of O6-methylguanine-DNA methyltransferase in HCT116R cells is similar to that in HCT116 parental cells (Fig. 2). Our data indicates that HCT116R cells become resistant to combination therapy by mechanisms independent of direct repair of damaged DNA. Our results are consistent with the observation that the sensitivity of various xenograft tumors to combination treatment with TMZ and ABT-888 is independent of the expression levels of O6-methylguanine-DNA methyltransferase.1

Surprisingly, both the mRNA and protein levels of PARP-1 are greatly reduced in HCT116R cells (Fig. 2). As a result, HCT116R cells fail to generate PAR in response to hydrogen peroxide (Fig. 6). Our CGH data (data not shown) also reveals that there is no significant difference in PARP-1 gene copy number between HCT116 and HCT116R cells, indicating that the downregulation of PARP-1 is through transcriptional regulation as shown in our microarray study (Fig. 2). We also examined the methylation status of the PARP-1 gene, and there is no significant difference between HCT116R and parental HCT116 cells (data not shown). It is also interesting to note that the mRNA level of PARP-2 is not downregulated in HCT116R cells even though ABT-888 inhibits PARP-2 to a similar extent in vitro. It is possible that the protein level of PARP-2 is so low that its PARP activity is negligible, although we cannot rule out the possibility that PARP-2 may function differently from PARP-1 in BER. The reason why HCT116R cells prefer the absence of PARP-1 is not clear. One possibility is that PARP-1 is recruited to the DNA damage site and has to be removed later in the DNA repair process to allow other DNA repair proteins access to the damage sites. ABT-888 may lock PARP-1 in the DNA damage site and prevent its disassociation, which may hinder the efficient repair of DSB through the HR pathway (37). Alternatively, resistance could be generated through a two-step process. First, cells lose PARP-1 expression which reduces capacity for BER. This, in turn, leads to the overexpression of Rad51 to compensate for the loss of BER.

The breast cancer susceptibility genes BRCA1 and BRCA2 are frequently mutated in breast and ovarian cancer and play critical roles in HR by facilitating the assembly of Rad51 at the site of DNA damage (34). Recently, inhibition of PARP-1 has been shown to be synthetically lethal in combination with defects in BRCA1/2 as well as other genes in the HR pathway (26-28), which indicates that simultaneous inhibition of BER and HR is cytotoxic to cancer cells, most likely due to the fact that PARP inhibition leads to the persistence of endogenous SSBs which are converted to DSBs during DNA replication. The failure to efficiently repair these DSBs in the absence of functional HR leads to cell lethality. Restoration of BRCA function in BRCA-defective cancer cells may serve as one way to be resistant to the treatment with PARP inhibitor as a single agent (38). Our data indicates that acquired defects in BER and enhanced capacity for HR repair may mediate the resistance of cancer cells to combination treatment with TMZ and ABT-888. These results suggest a novel mechanism of resistance to combination therapy in which the HR and BER pathways interact to regulate cancer cell viability.

Our microarray data indicate that changes in the expressions of genes involved in pathways other than DNA repair may also contribute to the observed resistance (Supplement Fig. S1), For example, significant changes in gene expression were observed in genes that regulate cell cycle control such as cyclin A2, centromere protein E/M/N, and p57KIP2. Additional studies will be required to determine if any of these additional factors contribute significantly to the resistance phenotype described here.

Materials and Methods

Chemicals

All chemicals were from Sigma. Protein concentration was determined using the BCA method (Pierce).

Cell Lines

HCT116 cells were obtained from the American Type Culture Collection. To generate HCT116 cells resistant to TMZ/ABT-888, 10 million HCT116 cells were incubated with 0.3 mmol/L of TMZ and 10 μmol/L of ABT-888 for 3 wk. Three colonies, designated HCT116-C1, HCT116-C2, and HCT116-C3, were isolated and grown in 96-well plates, 24-well plates, and T-75 flasks sequentially to amplify the cell population. Experiments with these resistant cells were carried out after the cells were grown in the absence of TMZ/ABT-888 for 1 wk.

Western Blot Analysis

Cells from 10 cm dishes were harvested and lysed in 200 μL of buffer A [20 mmol/L Hepes (pH 7.5), 10 mmol/L NaCl, 20 mmol/L NaF, 1 mmol/L EDTA, 1 mmol/L EGTA, 5 mmol/L sodium pyrophosphate, 2 mmol/L sodium vanadate, 10 mmol/L β-glycerolphosphate, and 1% NP40] on ice for 30 min. The samples were centrifuged at 12,000 × g at 4°C for 10 min. Cell lysates were subjected to SDS-PAGE and western analysis. Rabbit anti-BLM antibody was purchased from Bethyl Laboratories. Goat anti-ATM antibody was purchased from Abcam, Inc. Rabbit anti-PARP antibody was purchased from Cell Signaling. Anti-actin, anti-Chk1, anti-Chk2, anti-Rad51, anti-Ku70, anti-NBS1, and anti–DNA-PK antibodies were from Santa Cruz Biotechnology. Polyclonal anti-PAR antibody was from Trevigen. Western blot analysis was done using enhanced chemiluminescence detection reagents (Amersham) according to the instructions of the manufacturer.

Caspase-3 Activity Assay

Cells from each treatment condition (30,000 cells) were harvested and diluted in 100 μL culture medium and placed into a 96-well plate in triplicates. The caspase-3 activity assay was carried out with the caspase-3/7 glow assay (Promega) according to the instructions of the manufacturer.

siRNA Transfection

The on-target plus Rad51 siRNA and luciferase siRNA for control (sequence: AACGUACGCGGAAUACUUCGA) were from Dharmacon. For transfection, 0.6 × 106 cells were plated in a 10-cm dish on day 0. On day 1, 60 μL of LipofectAMINE 2000 (LF2000; Invitrogen) was added to 1.5 mL of Opti-MEM (Invitrogen) and incubated at room temperature for 5 min (solution A). Then the siRNAs were added to 1.5 mL of Opti-MEM (solution B). Solution A and solution B were mixed and incubated at room temperature for 20 min. The medium in the plate was reduced to 1 mL and the LF2000-siRNA mixture was laid onto the cells. Four hours after incubation at 37°C in a CO2 incubator, medium was replaced with complete medium. The cells were harvested 96 h posttransfection for cell number determination, caspase assay and Western blot analysis.

AlamarBlue Cell Proliferation Assay

Cells were plated at 750 cells per well in a 96-well plate. Cells were then cotreated with TMZ and ABT-888 for 5 d. AlamarBlue assay was carried out according to the instructions of the manufacturer (Biosource, Int., Inc.). Briefly, medium was removed from the plate, and 100 μL of AlamarBlue solution (10% AlamarBlue in complete culture medium) was added to each well. After 3 h, the plate was read on an fmax Fluorescence Microplate Reader (Molecular Devices) using an excitation wavelength of 544 nm and an emission wavelength of 595 nm. Data were analyzed using SOFTmax PRO software (Molecular Devices). Each data point represents the average of three determinations.

γH2AX Assay

Cells were fixed with 250 μL of BD Cytofix/Cytoperm solution (BD Bioscience) at room temperature for 20 min followed by washing thrice with 1XBD Perm/Wash Solution (BD Bioscience). After blocking with 3% bovine serum albumin for 30 min, the cells were incubated with the following antibodies in Perm/Wash Solution with washes in between: mouse anti-γH2AX antibody (1:250; Upstate Biotechnologies) and Alexa 488 goat anti-mouse IgG(H+L)F(ab′)2 fragment conjugate (1:200; Invitrogen). The DNA was immunostained with 50 μg/mL of propidium iodide in staining buffer [PBS without Mg2+ or Ca2+, 1% heat-inactivated FCS, and 0.09% (w/v) sodium azide (pH 7.4-7.6)] for 10 min in the dark. Immuno-flow cytometry was done to quantify the γH2AX signal. Each data point is the average of two values.

Microarray Analysis

Cell samples were lysed and total RNA was isolated using QIAshredder and RNeasy columns (Qiagen). Total RNA (5 μg) was used for microarray analysis. Labeled cRNA was prepared according to the microarray manufacturer's protocol and hybridized to human genome U133A 2.0 arrays (Affymetrix, Inc.). The intensity files were imported into Rosetta Resolver gene expression analysis software version 6.0 (Rosetta Inpharmatics). Resolver's Affymetrix error model was applied, and replicates were combined. Expression profiles were derived from mRNA from three independent samples for each cell line. Significant expression changes were identified using a 5% false discovery rate (39).

Colony Formation Assay

Cells were irradiated with Xrad320 at 320 kV at 1 Gy/min dose rate (Precision X-Ray). Twenty-four hours after radiation, 200 cells were seeded into six-well plates in triplicates. The cells were allowed to grow for 10 d and then fixed with methanol and stained with Giemsa (Sigma) to visualize colonies.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We thank Dr. Tamar Uziel for critically reading the manuscript.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/).

  • ↵1Palma et al., manuscript submitted.

    • Received July 7, 2009.
    • Revision received August 6, 2009.
    • Accepted August 7, 2009.
  • © 2009 American Association for Cancer Research.

References

  1. ↵
    1. Schreiber V,
    2. Dantzer F,
    3. Ame JC,
    4. de Mucia G
    . PolyADP-ribose: novel functions for an old molecule. Nat Rev Mol Cell Biol 2006;7:517–28.
    OpenUrlCrossRefPubMed
  2. ↵
    1. Amé JC,
    2. Spenlehauer C,
    3. de Murcia G
    . The PARP superfamily. Bioessays 2004;26:882–93.
    OpenUrlCrossRefPubMed
  3. ↵
    1. Helleday T,
    2. Petermann E,
    3. Lundin C,
    4. Hodgson B,
    5. Sharma RA
    . DNA repair pathways as targets for cancer therapy. Nat Rev Cancer 2008;8:193–204.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Amé JC,
    2. Rolli V,
    3. Schreiber V,
    4. et al
    . PARP-2, A novel mammalian DNA damage-dependent poly(ADP-ribose) polymerase. J Biol Chem 1999;274:17860–8.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Kawamitsu H,
    2. Hoshino H,
    3. Okada H,
    4. Miwa M,
    5. Momoi H,
    6. Sugimura T
    . Monoclonal antibodies to poly(adenosine diphosphate ribose)recognize different structures. Biochemistry 1984;23:3771–77.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Curtin NJ
    . PARP inhibitors for cancer therapy. Expert Rev Mol Med 2005;7:1–20.
    OpenUrlCrossRefPubMed
  7. ↵
    1. Almeida KH,
    2. Sobol RW
    . A unified view of base excision repair: lesion-dependent protein complexes regulated by post-translational modification. DNA Repair (Amst) 2007;6:695–711.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Curtin NJ
    . Therapeutic potential of drugs to modulate DNA repair in cancer. Expert Opin Ther Targets 2007;11:783–99.
    OpenUrlPubMed
  9. ↵
    1. Tomoda T,
    2. Kurashige T,
    3. Moriki T,
    4. Yamamoto H,
    5. Fujimoto S,
    6. Taniguchi T
    . Enhanced expression of poly(ADP-ribose) synthetase gene in malignant lymphoma. Am J Hematol 1991;37:223–7.
    OpenUrlCrossRefPubMed
  10. ↵
    1. Shiobara M,
    2. Miyazaki M,
    3. Ito H,
    4. et al
    . Enhanced polyadenosine diphosphate-ribosylation in cirrhotic liver and carcinoma tissues in patients with hepatocellular carcinoma. J Gastroenterol Hepatol 2001;16:338–44.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Fukushima M,
    2. Kuzuya K,
    3. Ota K,
    4. Ikai K
    . Poly(ADP-ribose) synthesis in human cervical cancer cell-diagnostic cytological usefulness. Cancer Lett 1981;14:227–36.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Wielckens K,
    2. Garbrecht M,
    3. Kittler M,
    4. Hilz H
    . ADP-ribosylation of nuclear proteins in normal lymphocytes and in low-grade malignant non-Hodgkin lymphoma cells. Eur J Biochem 1980;104:279–87.
    OpenUrlPubMed
  13. ↵
    1. Bakkenist CJ,
    2. Kastan MB
    . DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 2003;421:499–506.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Stiff T,
    2. Mark OD,
    3. Rief N,
    4. Iwabuchi K,
    5. Löbrich M,
    6. Jeggo PA
    . ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation. Cancer Res 2004;64:2390–6.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Ward IM,
    2. Chen J
    . Histone H2AX is phosphorylated in an ATR-dependent manner in response to replicational stress. J Biol Chem 2001;276:47759–62.
    OpenUrlAbstract/FREE Full Text
    1. Burma S,
    2. Chen BP,
    3. Murphy M,
    4. Kurimasa A,
    5. Chen DJ
    . ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J Biol Chem 2001;276:42462–7.
    OpenUrlAbstract/FREE Full Text
    1. Lukas C,
    2. Melander F,
    3. Stucki M,
    4. et al
    . Mdc1 couples DNA double-strand break recognition by Nbs1 with its H2AX-dependent chromatin retention. EMBO J 2004;23:2674–83.
    OpenUrlCrossRefPubMed
    1. Paull TT,
    2. Rogakou EP,
    3. Yamazaki V,
    4. Kirchgessner CU,
    5. Gellert M,
    6. Bonner WM
    . A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol 2000;10:886–95.
    OpenUrlCrossRefPubMed
  16. ↵
    1. Rogakou EP,
    2. Pilch DR,
    3. Orr AH,
    4. Ivanova VS,
    5. Bonner WM
    . DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 1998;273:5858–68.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Baumann P,
    2. Benson FE,
    3. West SC
    . Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro. Cell 1996;87:757–66.
    OpenUrlCrossRefPubMed
  18. ↵
    1. Taneja N,
    2. Davis M,
    3. Choy John S,
    4. et al
    . Histone H2AX phosphorylation as a predictor of radiosensitivity and target for radiotherapy. J Biol Chem 2004;279:2273–80.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Olive PL,
    2. Banáth JP,
    3. Sinnott LT
    . Phosphorylated histone H2AX in spheroids, tumors, and tissues of mice exposed to etoposide and 3-amino-1,2,4-benzotriazine-1,3-dioxide. Cancer Res 2004;64:5363–9.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Liu X,
    2. Shi Y,
    3. Guan R,
    4. et al
    . Potentiation of temozolomide cytotoxicity by polyADPribose polymerase inhibitor ABT-888 requires a conversion of single-stranded DNA damages to double-stranded DNA breaks. Mol Cancer Res 2008;6:1621–9.
    OpenUrlAbstract/FREE Full Text
  21. ↵
    1. D'Atri S,
    2. Tentori L,
    3. Lacal PM,
    4. et al
    . Involvement of the mismatch repair system in temozolomide-induced apoptosis. Mol Pharmacol 1998;54:334–41.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    1. Liu L,
    2. Schwartz S,
    3. Davis BM,
    4. Gerson SL
    . Chemotherapy-induced O6-benzylguanine-resistant alkyltransferase mutations in mismatch-deficient colon cancer. Cancer Res 2002;62:3070–6.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Bryant HE,
    2. Schultz N,
    3. Thomas HD,
    4. et al
    . Specific killing of BRCA2-deficient tumours with inhibitors of poly ADP-ribose polymerase. Nature 2005;434:913–7.
    OpenUrlCrossRefPubMed
  24. ↵
    1. Farmer H,
    2. McCabe N,
    3. Lord CJ,
    4. et al
    . Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 2005;434:917–21.
    OpenUrlCrossRefPubMed
  25. ↵
    1. McCabe N,
    2. Turner NC,
    3. Lord CJ,
    4. et al
    . Deficiency in the repair of DNA damage by homologous recombination and sensitivity to polyADP-ribose polymerase inhibition. Cancer Res 2006;66:8109–15.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Donawho CK,
    2. Luo Y,
    3. Luo Y,
    4. et al
    . ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models. Clin Cancer Res 2007;13:2728–37.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Huang da W,
    2. Sherman BT,
    3. Lempicki RA
    . Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2009;4:44–57.
    OpenUrlCrossRefPubMed
  28. ↵
    1. Vispé S,
    2. Cazaux C,
    3. Lesca C,
    4. Defais M
    . Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation. Nucleic Acids Res 1998;26:2859–64.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Raderschall E,
    2. Stout K,
    3. Freier S,
    4. Suckow V,
    5. Schweiger S,
    6. Haaf T
    . Elevated levels of Rad51 recombination protein in tumor cells. Cancer Res 2002;62:219–25.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Sonoda E,
    2. Hochegger H,
    3. Saberi A,
    4. Taniguchi Y,
    5. Takeda S
    . Differential usage of non-homologous end-joining and homologous recombination in double strand break repair. DNA Repair (Amst) 2006;5:1021–9.
    OpenUrlCrossRefPubMed
  31. ↵
    1. Gudmundsdottir K,
    2. Ashworth A
    . The roles of BRCA1 and BRCA2 and associated proteins in the maintenance of genomic stability. Oncogene 2006;25:5864–74.
    OpenUrlCrossRefPubMed
    1. Wilson JB,
    2. Yamamoto K,
    3. Marriott AS,
    4. et al
    . FANCG promotes formation of a newly identified protein complex containing BRCA2, FANCD2 and XRCC3. Oncogene 2008;27:3641–52.
    OpenUrlCrossRefPubMed
  32. ↵
    1. Nimonkar AV,
    2. Ozsoy A,
    3. Zeynep GJ,
    4. Modrich P,
    5. Kowalczykowski SC
    . Human exonuclease 1 and BLM helicase interact to resect DNA and initiate DNA repair. Proc Natl Acad Sci U S A 2008;105:16906–11.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    1. Satoh MS,
    2. Lindahl T
    . Role of poly(ADP-ribose) formation in DNA repair. Nature 1992;356:356–8.
    OpenUrlCrossRefPubMed
  34. ↵
    1. Edwards SL,
    2. Brough R,
    3. Lord CJ,
    4. et al
    . Resistance to therapy caused by intragenic deletion in BRCA2. Nature 2008;451:1111–5.
    OpenUrlCrossRefPubMed
  35. ↵
    1. Benjamini Y,
    2. Hochberg Y
    . Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B 1995;57:289–300.
    OpenUrl
PreviousNext
Back to top
Molecular Cancer Research: 7 (10)
October 2009
Volume 7, Issue 10
  • Table of Contents
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Molecular Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Acquired Resistance to Combination Treatment with Temozolomide and ABT-888 Is Mediated by Both Base Excision Repair and Homologous Recombination DNA Repair Pathways
(Your Name) has forwarded a page to you from Molecular Cancer Research
(Your Name) thought you would be interested in this article in Molecular Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Acquired Resistance to Combination Treatment with Temozolomide and ABT-888 Is Mediated by Both Base Excision Repair and Homologous Recombination DNA Repair Pathways
Xuesong Liu, Edward K. Han, Mark Anderson, Yan Shi, Dimitri Semizarov, Gang Wang, Thomas McGonigal, Lisa Roberts, Loren Lasko, Joann Palma, Gui-dong Zhu, Thomas Penning, Saul Rosenberg, Vincent L. Giranda, Yan Luo, Joel Leverson, Eric F. Johnson and Alexander R. Shoemaker
Mol Cancer Res October 1 2009 (7) (10) 1686-1692; DOI: 10.1158/1541-7786.MCR-09-0299

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Acquired Resistance to Combination Treatment with Temozolomide and ABT-888 Is Mediated by Both Base Excision Repair and Homologous Recombination DNA Repair Pathways
Xuesong Liu, Edward K. Han, Mark Anderson, Yan Shi, Dimitri Semizarov, Gang Wang, Thomas McGonigal, Lisa Roberts, Loren Lasko, Joann Palma, Gui-dong Zhu, Thomas Penning, Saul Rosenberg, Vincent L. Giranda, Yan Luo, Joel Leverson, Eric F. Johnson and Alexander R. Shoemaker
Mol Cancer Res October 1 2009 (7) (10) 1686-1692; DOI: 10.1158/1541-7786.MCR-09-0299
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Results
    • Discussion
    • Materials and Methods
    • Disclosure of Potential Conflicts of Interest
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • A Cross-species Alkylation Functionome
  • Radiation-Induced EGFR-DNA-PKcs Interactions
  • Suberoylanilide Hydroxamic Acid Inhibits Homolog-Directed Repair
Show more DNA Damage and Cellular Stress Responses
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • Rapid Impact Archive
  • Meeting Abstracts

Information for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About MCR

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Molecular Cancer Research
eISSN: 1557-3125
ISSN: 1541-7786

Advertisement