Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • Log out
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Rapid Impact Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Metabolism Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Spotlight on Genomic Analysis of Rare and Understudied Cancers
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Molecular Cancer Research
Molecular Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Rapid Impact Archive
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Metabolism Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Spotlight on Genomic Analysis of Rare and Understudied Cancers
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

DNA Damage and Cellular Stress Responses

The Circadian Gene NPAS2, a Putative Tumor Suppressor, Is Involved in DNA Damage Response

Aaron E. Hoffman, Tongzhang Zheng, Yue Ba and Yong Zhu
Aaron E. Hoffman
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tongzhang Zheng
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yue Ba
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yong Zhu
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1158/1541-7786.MCR-07-2094 Published September 2008
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Apart from regulating sleep and wakefulness, the circadian system may play an important role in other biological processes, including pathways involved in tumorigenesis. Two genetic association studies recently conducted by our lab have shown that a missense mutation in neuronal PAS domain protein 2 (NPAS2), a core circadian gene and transcriptional regulator, is significantly associated with risk of breast cancer and non–Hodgkin's lymphoma. Our current functional analyses provide the first in vitro evidence further demonstrating that cells with RNA interference–mediated depletion of NPAS2 fail to exhibit the expected cell cycle delay in response to mutagen treatment. DNA repair capacity, as measured by the comet assay, is also impaired. Moreover, a pathway-based PCR expression array of genes important for DNA damage signaling showed that knockdown of NPAS2 significantly represses the expression of several cell cycle and DNA repair genes. Thus, NPAS2 may play a role in tumorigenesis by affecting expression of cancer-related genes and could be considered a novel tumor suppressor. (Mol Cancer Res 2008;6(9):1461–8)

Keywords:
  • NPAS2
  • Circadian gene
  • Cell cycle
  • Apoptosis and DNA repair

Introduction

Mounting evidence that the circadian clock may function as a tumor suppressor at the systemic, cellular, and molecular levels through its involvement in cell proliferation, apoptosis, cell cycle control, and DNA damage response increasingly suggests a novel role for circadian rhythm and circadian genes in tumorigenesis (1, 2). Our recent genetic association studies have shown that a missense mutation (Ala394Thr) in neuronal PAS domain protein 2 (NPAS2), a core circadian gene and transcriptional regulator (3, 4), is a biomarker for individuals' susceptibility to two human cancer types, breast cancer and non–Hodgkin's lymphoma (5, 6). Although these molecular epidemiologic findings are the first evidence that NPAS2 might be involved in tumorigenesis, little is known about the underlying mechanisms.

NPAS2, the largest circadian gene, encodes for a member of the basic helix-loop-helix-PAS class of transcription factors that forms heterodimers with BMAL1 and is involved in the regulation of biological rhythms (7, 8). The NPAS2:BMAL1 heterodimer is part of the positive circadian feedback loop and may bind to E-box sequences in the promoter regions of target circadian genes, thereby activating their expression and regulating circadian rhythm (9, 10). In addition to regulating other circadian genes, NPAS2:BMAL1 heterodimers have been shown to affect expression of the proto-oncogene c-MYC (11). This finding implies potential involvement of NPAS2 in tumorigenesis that has not been fully explored.

In order to investigate the functional role of NPAS2 in cancer-related biological pathways, we did RNA interference–mediated knockdown of NPAS2 in vitro followed by a variety of functional assays related to DNA damage response. The findings, although preliminary, will further our understanding of the role of NPAS2 in tumorigenesis, and provide an important first step in elucidating the mechanisms by which this gene may be involved in cancer-related processes. In addition, these findings will aid in directing future studies concerning the effect of the circadian system on carcinogenesis.

Results

Expression of NPAS2 in the Cancer Cell Lines MCF-7 and HCT-15

It is now clear that molecular clocks reside not only in a central pacemaker, but also in peripheral tissues, even in immortalized cells (12, 13). Previous evidence suggests that circadian genes, including NPAS2, show detectable circadian mRNA expression in all tissues except testis (14). Before beginning our study we confirmed the presence of measurable levels of NPAS2 expression in MCF-7 and HCT-15 cells using quantitative reverse transcription PCR, as well as the presence of NPAS2 protein in MCF-7 cells by Western blot (data not shown). We then transfected the cells with small interfering RNA (siRNA) oligos targeting NPAS2 along with a scrambled negative siRNA oligo with no known homology to the human genome (mock siRNA). NPAS2 knockdown relative to mock-treated cells was quantitatively determined by quantitative reverse transcription PCR prior to each assay, and only those populations with >70% reduction were used in subsequent analyses.

NPAS2 Knockdown Affects Expression of Cancer-Related Genes

We did a pathway-based PCR expression array (SuperArray Bioscience) to determine the effect of NPAS2 silencing in MCF-7 cells on the expression profile of 84 genes with established roles in DNA damage signaling. Consistent with NPAS2's role as a transcriptional enhancer, 74 genes (91.4%) were down-regulated, and 22 genes (27.2%) were down-regulated by 2-fold or more compared with cells with normal NPAS2 levels. Only seven genes showed increased expression (8.6%), none of which were significantly different from the negative control (Fig. 1 ). We compared gene expression in NPAS2 knockdown cells with that of cells with normal NPAS2 expression using the Student's t test. At the nominal P value of 0.05, 27 genes were significantly down-regulated, whereas only 4.2 (84 × 0.05) would be expected to be significant by chance alone. However, the magnitude of many of these changes was small, and therefore, may not be biologically relevant. As such, we considered a gene to have significantly altered expression only if it displayed >2-fold up-regulation or down-regulation, and had a P value of <0.05. Seven genes with a variety of functional roles fit this criteria for significant down-regulation, including genes important for cell cycle checkpoint control (FANCG), damaged DNA binding (DMC1, DDB1, and MSH2), double-strand break repair (PRKDC), cell cycle arrest (MAPK12), and mismatch repair (EXO1; Table 1 ). In order to further confirm these findings, and to determine whether the observed response was specific to MCF-7 cells, we repeated the NPAS2 knockdown experiment and PCR expression array using a colorectal adenocarcinoma cell line (HCT-15). Using the nominal P value of 0.05, eight genes were significantly down-regulated, and again, no genes were significantly up-regulated. Although no genes fit the original significance criteria of fold change of >2 and P value of <0.05, the three genes most significantly altered according to the t test alone were also identified as significant in MCF-7 cells. Given that none of the DNA damage–responsive genes included in the array were altered by 2-fold or more following NPAS2 knockdown in the HCT-15 cells, we did the subsequent functional analyses on MCF-7 cells only.

FIGURE 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 1.

Three-dimensional profile of expression differences among genes related to the DNA damage response pathway following NPAS2 silencing in MCF-7 cells as measured by pathway-specific PCR array (SuperArray). Twenty-two of the 81 genes measured (27.2%) had a >2-fold reduced expression and 73 (91.4%) were down-regulated. Of the seven genes with increased expression, none increased by >1.31-fold. The data are a result of two replicates from two independent experiments.

View this table:
  • View inline
  • View popup
Table 1.

Genes with P < 0.05 (HCT-15) or >2-fold Changes in Expression and P < 0.05 (MCF-7) following NPAS2 Knockdown, as Determined by DNA Damage Repair PCR Expression Array

Reduced NPAS2 Expression Affects Cell Cycle Checkpoints

We did flow cytometric analyses to determine the effect of NPAS2 silencing on cell cycle progression in response to exposure to the chemical mutagen methyl methanesulfonate (MMS). MCF-7 cells were transfected with either NPAS2-targeting or scrambled negative siRNA. Forty-eight hours after transfection, cells were treated with either 0.015% of MMS or PBS for 1 hour, washed, and then left under normal conditions for an additional 24 hours. Harvested cells were then analyzed by flow cytometry and cell phases were determined. As expected, the cell phase distribution of the cell population with normal NPAS2 expression was significantly different among those treated with PBS compared with MMS (χ22 = 13.777; P = 0.001; Fig. 2 ). Mutagen-treated cells with normal NPAS2 expression were more likely to be in G1 or G2 phase, corresponding to the major cell cycle checkpoints for DNA damage repair, whereas the number of cells in S phase was significantly reduced. However, among cells with reduced NPAS2 expression, there was no significant difference between cells treated with PBS and those treated with MMS (χ22 = 3.830; P = 0.147), indicating an aberrant response to DNA damage. Furthermore, there was a significant difference in the cell cycle distribution of normal and NPAS2 knockdown populations among cells not treated with mutagen (χ22 = 6.096; P = 0.0475). This difference was even more pronounced among mutagen-treated cells (χ22 = 10.109; P = 0.006).

FIGURE 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 2.

Reduced NPAS2 expression leads to changes in cell cycle distribution among mutagen-treated and mock-treated MCF-7 cells. Cells were either treated with scrambled negative or NPAS2-targeting siRNA oligos, and either 0.015% (v/v) MMS or PBS. Cell cycle distribution was determined 24 h after MMS/PBS treatment and 72 h after siRNA treatment. Data was collected on an average of 47,060 cells per sample (range, 40,335-50,609), and cell phases were determined using the Watson pragmatic algorithm. The cell phase distributions were 44% G1, 35% S, and 21% G2-M for cells treated with siRNA−/MMS− (A); 51% G1, 20% S, and 29% G2-M for cells treated with siRNA+/MMS− (B); 61% G1, 13% S, and 26% G2-M for cells treated with siRNA−/MMS+ (C); and 47% G1, 32% S, and 22% G2-M for cells treated with siRNA+/MMS+ (D); percentages may not sum to 100 due to rounding. The cell phase distribution was significantly different between treatments siRNA−/MMS− and siRNA−/MMS+ (χ22 = 13.777; P = 0.001) but not between siRNA+/MMS− and siRNA+/MMS+ (χ22 = 3.830; P = 0.147), indicating an improper response to mutagen treatment among cells with reduced NPAS2 expression. Normal cells respond to mutagen treatment with a significant G1-G2 delay, as expected, whereas NPAS2 knockdown cells do not display a significant change in cell cycle distribution (E).

Reduced NPAS2 Expression Affects DNA Repair Capacity

The alkaline single-cell gel electrophoresis assay (comet assay) was used to assess differences in DNA damage accumulation and repair capacity between cells with normal NPAS2 expression and those with reduced NPAS2 expression in MCF-7 cells. After the siRNA and MMS/PBS treatments mentioned above, cells were washed in PBS, then incubated in normal medium for 3 hours, followed by comet assay analysis. The mean Olive tail moment was determined for 50 cells from each of the four treatment groups (siRNA-positive/siRNA-negative and MMS-positive/MMS-negative) and all pairwise comparisons were examined using Fisher's protected least significant difference (Fig. 3 ). Longer “tails” associated with an individual cell corresponded to greater accumulation of damage, as the head consists of intact DNA whereas the tail material is comprised of damaged DNA. Among the samples not treated with mutagen, the difference in tail moment between cells with reduced and normal NPAS2 expression was not significant (P = 0.668), indicating that without inducing damage, there is no difference in repair. However, among the mutagen-treated populations, cells with reduced NPAS2 had significantly longer mean tail moments (P = 0.002), suggesting decreased DNA repair capacity compared with cells with normal NPAS2 expression. All other comparisons were significant, as expected.

FIGURE 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 3.

DNA damage repair capacity assessed by the Comet assay. A. Representative cell images from each of the four treatments. Mean Olive tail moment (B) determined from 50 cells from each of the four treatment groups was 0.292 ± 0.037 for siRNA−/MMS−, 1.003 ± 0.164 for siRNA−/MMS+, 0.204 ± 0.026 for siRNA+/MMS−, and 1.654 ± 0.235 for siRNA+/MMS+. All pairwise comparisons were examined using Fisher's protected least significant difference. Among the samples not treated with mutagen, the difference in tail moment between cells with reduced and normal NPAS2 expressions was not significant (P = 0.668), indicating that without inducing damage, there is no difference in repair. However, among the mutagen-treated populations, cells with reduced NPAS2 had a significantly longer mean tail moment (P = 0.0018) as depicted in Fig. 4B, indicating decreased DNA repair capacity compared with cells with normal NPAS2 expression. As expected, all other comparisons were significant (P < 0.001).

Effect of Reduced NPAS2 Expression on Apoptosis and Cell Viability

A similar protocol was used to assess differences in cell viability and apoptotic response to mutagen exposure between cells with normal NPAS2 expression and those with reduced levels of NPAS2. MCF-7 cells were treated as described in the cell cycle experiment, with the exception that cells were harvested 48 hours after MMS or PBS treatment to allow additional time for the initiation of the apoptotic response. Percentages were then determined for early apoptotic, live, and dead cells for each treatment population. For the cell viability comparison, siRNA-positive samples were compared with siRNA-negative samples for each MMS or PBS treatment. For the apoptosis comparison, MMS-treated cells were compared with PBS-treated cells in each of the siRNA treatment groups. In both mutagen-treated and nontreated populations, cells with reduced NPAS2 expression were significantly less viable than normal cells (P = 0.001 and P = 0.003, respectively), indicating that NPAS2 knockdown alone was sufficient to elicit increased vulnerability to cell death (Fig. 4 ). However, in both NPAS2 knockdown and normal cells, treatment with MMS resulted in significantly increased levels of apoptosis (P = 0.037 and P = 0.027, respectively), suggesting that NPAS2 may not directly hinder the apoptotic process.

FIGURE 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIGURE 4.

Representative flow cytometry results for each of the four treatments (A). Live cells (bottom left), early apoptotic cells (bottom right), and necrotic cells (top). Cells were stained with propidium iodide (Y-axis) along with Annexin V (X-axis) and 10,000 cells were counted. Cells were then categorized as live, dead, apoptotic, or ambiguous. B. Percentage of live cells for each treatment from two independent experiments. In both mutagen-treated and nontreated populations, cells with reduced NPAS2 expression were significantly less viable (P = 0.001 and P = 0.003, respectively). C. Percentage of the total population undergoing early apoptosis for each treatment from two independent experiments. Comparisons are between MMS-treated and PBS-treated cell populations in each siRNA treatment group (*, P < 0.05, significant difference). Both normal and NPAS2 knockdown cells exhibit increased apoptosis following mutagen exposure (P = 0.027 and P = 0.037, respectively), suggesting that NPAS2 itself does not directly hinder the apoptotic response.

Discussion

It has been suggested that the disruption of circadian rhythm may have broad consequences at the molecular level, as previous evidence has shown that 2% to 10% of all mammalian genes display circadian oscillation (15, 16). The results presented here contribute to increasing evidence suggesting an important role for NPAS2 in transcriptional regulation, but the full extent to which it is involved in disease-related pathways remains to be elucidated (4). Although previous reports have suggested that NPAS2 may directly regulate other genes in the circadian regulatory system (9, 10), our current study shows that genes involved in cancer-related biological pathways are also influenced by NPAS2, which could explain the observed functional effect of NPAS2 knockdown on cell cycle progression and DNA repair capacity, as well as the epidemiologic evidence suggesting an association between polymorphisms in NPAS2 and cancer risk (5, 6). In addition to previous studies demonstrating the importance of another circadian gene, PER2, in tumor suppression (17, 18), our findings further highlight the relevance of the circadian system to carcinogenesis, pointing to an area that is perhaps understudied in the field of cancer research (19).

Although it is not clear whether any of the genes identified in the PCR expression array are regulated by NPAS2 directly, it is of note that of the eight functional gene groups represented in the array (apoptosis, cell cycle arrest, cell cycle checkpoint, double-strand break repair, damaged DNA binding, base-excision repair, mismatch repair, and other genes related to DNA repair) only the apoptotic pathway did not have a single gene significantly affected by NPAS2 knockdown in either cell type. This is consistent with the functional findings which suggest that NPAS2 silencing decreases cell viability, results in aberrant cell cycle response to DNA damage, and decreases DNA damage repair capacity, but does not alter the apoptotic response. It is also of note that the array results imply a significantly more prominent role for NPAS2 in breast cancer cell lines compared with cells derived from colorectal cancer. Although expression of some genes in the array was affected by NPAS2 knockdown in the HCT-15 cells, the effect was much less profound than that observed in MCF-7 cells, and none reached our significance criteria of P < 0.05 and >2-fold expression change. These data suggest that the role of NPAS2 may vary according to cancer type, and as such, the results presented here, although relevant to breast cancer, may not necessarily translate uniformly across other cancer types.

An important limitation of our methodology is that cells were only transiently transfected with siRNA oligos, and therefore, silencing of NPAS2 could not be stably induced and successfully transfected cells could not be exclusively selected. As a result, we could not assess the long-term effects of reduced NPAS2 expression on cell viability or other relevant pathways, nor could we achieve 100% silencing of NPAS2. However, because the reduction in NPAS2 expression was quantified prior to each assay, this does not affect the interpretation of the results presented here, but it does provide an avenue for further research. In addition, these findings provide only indirect support for the role of NPAS2 as a transcriptional regulator of cancer-related genes. More direct evidence is needed in order to determine whether the genes implicated here are directly targeted by NPAS2, or whether their expression is altered indirectly via some other mechanism. This could be achieved via ChIP-on-chip assay using NPAS2-specific antibodies and a targeted or whole-genome promoter array.

Together, our observations indicate important functional consequences of the circadian gene NPAS2 on DNA damage response, a key pathway related to tumorigenesis. Although epidemiologic evidence has linked NPAS2 with a variety of disorders, including winter depression (20) and autistic disorder (21), as well as cancer (5, 6), this is the first functional evidence demonstrating a broad role for NPAS2 in tumorigenesis. Although this study does not definitively address all of the questions relevant to the relationship between NPAS2 and carcinogenesis, we do believe that it is an important first step in elucidating the mechanisms by which this gene may be involved in tumorigenesis. These findings lend further support to the view that circadian genes may serve as a novel group of tumor suppressor genes and provide a molecular basis for the epidemiologic observations that disruption of circadian rhythm is a risk factor for the development of several cancer types (22-24).

Materials and Methods

Cell Culture and Treatments

Human breast adenocarcinoma cells (MCF-7) and colorectal adenocarcinoma cells (HCT-15) were obtained from American Type Culture Collection. MCF-7 cells were maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) and 0.01 mg/mL of bovine insulin (Sigma-Aldrich). HCT-15 cells were maintained in RPMI 1640 (Invitrogen) supplemented with 10% fetal bovine serum. For comparisons between cells treated with scrambled negative and NPAS2-targeting siRNA oligos, cells for each treatment were harvested from the same colony at the same time. In addition, all experiments were run in parallel to control for the effects of time and cyclic gene expression.

siRNA Transfections

siRNA oligos targeting NPAS2 (duplex 1: sense, GGGUGCCUCGGGCCUUAAUACCAGT; antisense, ACUGGUAUUAAGGCCCGAGGCACCCAC; duplex 2: sense, CCCAGGGUCCAAAGCCAAUGAGAAG; antisense, CUUCUCAUUGGCUUUG-GACCCUGGGUU; duplex 3: sense, GGCACACUCUAUAGCCAUACUGGAC; antisense, GUCCAGUAUGGCUAUAGAGUGUGCCCA), a scrambled-sequence negative control siRNA with no known homology to the human genome to control for the effects of transfection, a positive control targeting the constitutively expressed housekeeping gene HPRT, and a fluorescent-labeled transfection efficiency control were chemically synthesized by Integrated DNA Technologies. Each was diluted in Opti-Mem I reduced serum medium (Invitrogen) and complexed with Lipofectamine 2000 transfection reagent (Invitrogen) prior to transfection according to the manufacturer's instructions. Each oligo was added to a 12-well culture dish followed by ∼100,000 cells suspended in normal growth medium, for a final siRNA concentration of 10 nmol/L (reverse transfection). After 48 h, cells were either harvested for quantitative real-time reverse transcription PCR, or incubated with either PBS (pH 7.4; negative control) or 0.015% (v/v) of MMS (mutagenic agent) for use in subsequent assays. Cells transfected with the fluorescent oligo were visualized by fluorescence microscopy using an FITC filter. Fifty randomly selected cells were assessed for oligo uptake, and >90% were found to be successfully transfected.

Real-time Reverse Transcription PCR and Western Blot

RNA was isolated from both MCF-7 and HCT-15 using the RNA Mini Kit (Qiagen), with on-column DNA digestion, according to the manufacturer's instructions for mammalian cells. Quantitative real-time reverse transcription PCR conditions were prepared using the Quantitect one-step kit (Qiagen) according to the manufacturer's protocol. Primers for 18s rRNA and NPAS2 were designed in-house and chemically synthesized by IDT (18s, 5′-ATCAACTTTCGATGGTAGTCG-3′ and 5′-TCCTTGGATGTGGTAGCCG-3′; NPAS2, 5′-TCTGGATCACAGAGCACCTC-3′ and 5′-CAGGAGCTCCAGGTCATCA-3′). Standard duplicated quantitative reverse transcription PCRs with disassociation curves were done on a Stratagene MX3000P instrument (Stratagene). RNA quantity was normalized to 18s rRNA, and changes in RNA expression were quantified according to the 2−ΔΔCt method. To detect NPAS2 protein expression in MCF-7, we also did a standard Western blot using lysate of MCF-7 and rabbit polyclonal anti-NPAS2 (sc-28708; Santa Cruz Biotechnology).

Pathway-Specific Expression Array

Once NPAS2 knockdown was confirmed (>2-fold reduction by quantitative reverse transcription PCR), the human DNA damage signaling RT2 profiler PCR array (SuperArray Bioscience) was used to assess the effect of NPAS2 reduction on the expression of 84 genes with known roles in DNA damage response. Synthesis of complementary DNA, real-time PCR, and statistical analyses were done according to the manufacturer's instructions, and the data shown represent the average of two replicates. Cycle thresholds were determined for each PCR product, with amplification curves occurring later than a cycle 35 considered failed or unexpressed. Five housekeeping genes were included as RNA content controls, and the three with the lowest standard deviations across replicates were used in the analysis (for MCF-7: B2M, GAPDH, and ACTB; for HCT-15: B2M, GAPDH, and HPRT1). The average difference in cycle threshold between the first and second replicates for these genes in the siRNA-positive and siRNA-negative samples was 0.0 and 0.1 cycles for MCF-7, and 0.0 and 0.4 for HCT-15, respectively, indicating excellent stability and reproducibility. In addition, a genomic DNA control primer set was included in each PCR run which can detect the presence of DNA contamination in each sample. The Ct for this product is compared with the average of the housekeeping genes, with a ΔCt value of <4 indicating contamination. No sample came close to reaching this cutoff, and the average across all samples was 9.5 cycles (range, 7.5-10.3) for MCF-7. No genomic DNA was detected in the HCT-15 samples (Ct > 35). All samples also passed additional quality controls for reverse transcription and PCR efficiency provided by the manufacturer. Finally, three genes with failed PCR amplifications in one or more replicates were removed from the MCF-7 analysis.

Cell Cycle, Cell Viability, and Apoptosis Assays

For cell cycle analysis, cells were transfected with siRNA duplex 1 or negative control and incubated under normal conditions for 48 h (37°C, 5% CO2). Cells were then treated for 1 h with either MMS or PBS, washed and left overnight, and then harvested for analysis. Cells were incubated with propidium iodide stain and analyzed by flow cytometry using a fluorescence-activated cell sorter flow cytometer (Becton Dickinson) according to methods previously described. More than 40,000 cells were counted, and data was analyzed using the FlowJo flow cytometry analysis software (Tree Star, Inc.). Cell phases were determined by the software using the Watson pragmatic algorithm. For apoptosis and cell viability analyses, cells were stained with propidium iodide along with Annexin V using reagents in the Vybrant Apoptosis assay kit no. 2 (Invitrogen), according to the manufacturer's protocol. Ten thousand cells were counted, and each was categorized as live, dead, apoptotic, or ambiguous using the FlowJo flow cytometry analysis software (Tree Star, Inc). Cells that could not be definitively called by the software were excluded from the analysis, and percentages were calculated using the remaining population. All data are the result of two independent experiments.

DNA Damage Assay

DNA damage was assessed using the alkaline single-cell gel electrophoresis assay (comet assay). After the siRNA and MMS/PBS treatments mentioned above, cells were washed in PBS, then incubated in normal medium for 3 h. Cells were then harvested and mixed with low-melting agarose and fixed onto slides. The cells were then lysed and DNA was denatured using an alkaline (pH > 14) solution at 4°C. Slides were then placed on a horizontal electrophoresis device which allowed damaged and/or broken DNA to migrate away from the nucleus. Slides were then stained with ethidium bromide, visualized by fluorescence microscopy, and analyzed using the Komet 5 comet assay analysis software which quantitatively determines the extent of DNA damage in each sample using the mean Olive tail moment calculation as previously described (25).

Statistical Analysis

All statistical analyses were done using the SAS statistical software (SAS Institute), unless otherwise noted. Differences in cell cycle progression for cells treated with scrambled negative siRNA and NPAS2-targeting siRNA were determined using the Pearson χ2 test comparing the percentages of the total cell population in each phase of the cell cycle for both cell populations. Differences in apoptotic response were determined by the Student's t test comparing the percentage of early apoptotic cells in each cell population. Cell viability was also determined by t test of the percentage of live cells, and in both instances, tests for equality of variance were not significant and pooled variances were used. Data was collected on 10,000 cells per sample and the data shown are based on duplicate experiments. Statistical analysis of DNA damage repair capacity was done using the Komet 5 comet assay analysis software. Differences in DNA repair were determined for all pairwise associations of the four treatment groups (siRNA-positive/siRNA-negative and MMS-positive/MMS-negative) using Fisher's protected least significant difference for the mean Olive tail moment. Gene expression differences in the PCR expression array were determined using the 2−ΔΔCt method. If the gene was down-regulated, fold expression change was defined as −1 / (fold difference). For example, if the fold difference (2−ΔΔCt) of a gene was 0.5, this would be expressed as a 2-fold down-regulation, or a fold change of −2.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We are grateful to Chunhui Yi for assistance with antibody screening and Western blot. We also thank the flow cytometry core at Yale University for assistance with cell cycle and apoptosis assays.

Footnotes

  • Grant support: U.S. NIH grants CA122676, CA110937, and CA108369.

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    • Accepted May 27, 2008.
    • Received October 11, 2007.
    • Revision received April 22, 2008.
  • American Association for Cancer Research

References

  1. ↵
    Filipski E, King VM, Li X, et al. Host circadian clock as a control point in tumor progression. J Natl Cancer Inst 2002;94:690–7.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    Fu L, Lee CC. The circadian clock: pacemaker and tumour suppressor. Nat Rev Cancer 2003;3:350–61.
    OpenUrlCrossRefPubMed
  3. ↵
    Reick M, Garcia JA, Dudley C, McKnight SL. NPAS2: an analog of clock operative in the mammalian forebrain. Science 2001;293:506–9.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Dioum EM, Rutter J, Tuckerman JR, Gonzalez G, Gilles-Gonzalez MA, McKnight SL. NPAS2: a gas-responsive transcription factor. Science 2002;298:2385–7.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Zhu Y, Leaderer D, Guss C, et al. Ala394Thr polymorphism in the clock gene NPAS2: a circadian modifier for the risk of non-Hodgkin's lymphoma. Int J Cancer 2007;120:432–5.
    OpenUrlCrossRefPubMed
  6. ↵
    Zhu Y, Stevens RG, Leaderer D, et al. Non-synonymous polymorphisms in the circadian gene NPAS2 and breast cancer risk. Breast Cancer Res Treat 2008;107:421–5.
    OpenUrlPubMed
  7. ↵
    Vitaterna MH, King DP, Chang AM, et al. Mutagenesis and mapping of a mouse gene, Clock, essential for circadian behavior. Science 1994;264:719–25.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Bunger MK, Wilsbacher LD, Moran SM, et al. Mop3 is an essential component of the master circadian pacemaker in mammals. Cell 2000;103:1009–17.
    OpenUrlCrossRefPubMed
  9. ↵
    Asher G, Schibler U. A CLOCK-less clock. Trends Cell Biol 2006;16:547–9.
    OpenUrlPubMed
  10. ↵
    DeBruyne JP, Weaver DR, Reppert SM. CLOCK and NPAS2 have overlapping roles in the suprachiasmatic circadian clock. Nat Neurosci 2007;10:543–5.
    OpenUrlCrossRefPubMed
  11. ↵
    Fu L, Pelicano H, Liu J, Huang P, Lee C. The circadian gene Period2 plays an important role in tumor suppression and DNA damage response in vivo. Cell 2002;111:41–50.
    OpenUrlCrossRefPubMed
  12. ↵
    Reppert SM, Weaver DR. Coordination of circadian timing in mammals. Nature 2002;418:935–41.
    OpenUrlCrossRefPubMed
  13. ↵
    Schibler U, Sassone-Corsi P. A web of circadian pacemakers. Cell 2002;111:919–22.
    OpenUrlCrossRefPubMed
  14. ↵
    Yamamoto T, Nakahata Y, Soma H, Akashi M, Mamine T, Takumi T. Transcriptional oscillation of canonical clock genes in mouse peripheral tissues. BMC Mol Biol 2004;5:18.
    OpenUrlCrossRefPubMed
  15. ↵
    Storch KF, Lipan O, Leykin I, et al. Extensive and divergent circadian gene expression in liver and heart. Nature 2002;417:78–83.
    OpenUrlCrossRefPubMed
  16. ↵
    Lowrey PL, Takahashi JS. Mammalian circadian biology: elucidating genome-wide levels of temporal organization. Annu Rev Genomics Hum Genet 2004;5:407–41.
    OpenUrlCrossRefPubMed
  17. ↵
    Lee CC. Tumor suppression by the mammalian Period genes. Cancer Causes Control 2006;17:525–30.
    OpenUrlCrossRefPubMed
  18. ↵
    Hua H, Wang Y, Wan C, et al. Circadian gene mPer2 overexpression induces cancer cell apoptosis. Cancer Sci 2006;97:589–96.
    OpenUrlCrossRefPubMed
  19. ↵
    Ross K. Circadian rhythms play role in cancer research. J Natl Cancer Inst 2006;98:806–7.
    OpenUrlFREE Full Text
  20. ↵
    Partonen T, Treutlein J, Alpman A, et al. Three circadian clock genes Per2, Arntl, and Npas2 contribute to winter depression. Ann Med 2007;39:229–38.
    OpenUrlCrossRefPubMed
  21. ↵
    Nicholas B, Rudrasingham V, Nash S, Kirov G, Owen MJ, Wimpory DC. Association of Per1 and Npas2 with autistic disorder: support for the clock genes/social timing hypothesis. Mol Psychiatry 2007;12:581–92.
    OpenUrlCrossRefPubMed
  22. ↵
    Bullough JD, Rea MS, Figueiro MG. Of mice and women: light as a circadian stimulus in breast cancer research. Cancer Causes Control 2006;17:375–83.
    OpenUrlPubMed
  23. Davis S, Mirick DK. Circadian disruption, shift work and the risk of cancer: a summary of the evidence and studies in Seattle. Cancer Causes Control 2006;17:539–45.
    OpenUrlCrossRefPubMed
  24. ↵
    Stevens RG. Artificial lighting in the industrialized world: circadian disruption and breast cancer. Cancer Causes Control 2006;17:501–7.
    OpenUrlCrossRefPubMed
  25. ↵
    Olive PL, Banath JP, Durand RE. Heterogeneity in radiation-induced DNA damage and repair in tumor and normal cells measured using the “comet” assay. Radiat Res 1990;122:86–94.
    OpenUrlPubMed
View Abstract
PreviousNext
Back to top
Molecular Cancer Research: 6 (9)
September 2008
Volume 6, Issue 9
  • Table of Contents
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Molecular Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
The Circadian Gene NPAS2, a Putative Tumor Suppressor, Is Involved in DNA Damage Response
(Your Name) has forwarded a page to you from Molecular Cancer Research
(Your Name) thought you would be interested in this article in Molecular Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
The Circadian Gene NPAS2, a Putative Tumor Suppressor, Is Involved in DNA Damage Response
Aaron E. Hoffman, Tongzhang Zheng, Yue Ba and Yong Zhu
Mol Cancer Res September 1 2008 (6) (9) 1461-1468; DOI: 10.1158/1541-7786.MCR-07-2094

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
The Circadian Gene NPAS2, a Putative Tumor Suppressor, Is Involved in DNA Damage Response
Aaron E. Hoffman, Tongzhang Zheng, Yue Ba and Yong Zhu
Mol Cancer Res September 1 2008 (6) (9) 1461-1468; DOI: 10.1158/1541-7786.MCR-07-2094
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Results
    • Discussion
    • Materials and Methods
    • Disclosure of Potential Conflicts of Interest
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • A Cross-species Alkylation Functionome
  • Radiation-Induced EGFR-DNA-PKcs Interactions
  • Suberoylanilide Hydroxamic Acid Inhibits Homolog-Directed Repair
Show more DNA Damage and Cellular Stress Responses
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • Rapid Impact Archive
  • Meeting Abstracts

Information for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About MCR

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Molecular Cancer Research
eISSN: 1557-3125
ISSN: 1541-7786

Advertisement