Article Figures & Data
Figures
- Figure 1.
UBE2C expression is increased in endometrial cancer and high UBE2C expression is correlated with poor outcomes in endometrial cancer. A, The mRNA expression of UBE2C was examined in 23 fresh endometrial cancer and 10 normal endometrium specimens by qRT-PCR. B, Proteins from 14 endometrial cancer and 15 normal endometrium tissues were subjected to Western blot analysis to determine the protein level of UBE2C. The representative bands and the relative UBE2C protein expressions normalized to GAPDH are shown. C, The upregulation of UBE2C mRNA was validated in endometrial cancer cases from TCGA database. D, Differential mRNA expression level of UBE2C in the histologic grading of the TCGA database. E, UBE2C mRNA expression was increased in tumors with recurrence in TCGA samples. F, High expression of UBE2C was associated with worse pathologic type in TCGA samples. G, High expression of UBE2C was associated with higher FIGO stage in TCGA samples. H, The prognostic implication of UBE2C was revealed by Kaplan–Meier analysis in TCGA. High expression of UBE2C was correlated with unfavorable overall survival. (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).
- Figure 2.
UBE2C promotes cell proliferation, migration, invasion, and EMT in vitro. A, The protein expression of UBE2C in HEC-1B, Ishikawa, KLE, and RL95-2 cell lines. B, Cells were transfected with UBE2C shRNA and overexpression plasmid for the establishment of stable cell lines. The effects were confirmed by Western blot analysis. C, qRT-PCR confirmed the effects of cells transfected with UBE2C shRNA and overexpression plasmid. D, UBE2C knockdown reduces the proliferation of Ishikawa cells. Overexpression of UBE2C accelerates the proliferation of KLE cells. E, UBE2C knockdown inhibits Ishikawa cells migration and invasion. Representative data and statistical analyses were shown (magnification, 100 ×; mean ± SEM; n = 3; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001). F, Overexpression of UBE2C promotes KLE cells migration and invasion (magnification, 100 × ; mean ± SEM; n = 3; ***, P < 0.001). G, UBE2C knockdown increased E-cadherin expression and reduced vimentin expression by Western blot analysis in Ishikawa cells (mean ± SEM; n = 3; *, P < 0.05; **, P < 0.01). H, UBE2C overexpression decreased E-cadherin expression and increased vimentin expression by Western blot analysis in KLE cells. Statistical analysis of relative protein amount of E-cadherin and vimentin after UBE2C knockdown and overexpression are from three independent replicates. Data are presented as mean ± SEM (**, P < 0.01). I, The mRNA level of E-cadherin and vimentin expression after UBE2C knockdown and overexpression in Ishikawa and KLE cells, respectively (*, P < 0.05; **, P < 0.01).
- Figure 3.
UBE2C negatively regulates the p53 tumor suppressor. A, Western blot analysis shows that UBE2C knockdown and overexpression leads to upregulation and downregulation of p53 tumor suppressor and its downstream target p21, respectively. B, UBE2C knockdown and overexpression do not change the p53 mRNA level in the Ishikawa and KLE cell lines (mean ± SEM; n = 3; **, P < 0.01) C, The protein stability of p53 in UBE2C-expressing cells was determined by western blot analysis using cycloheximide (CHX). Overexpression of UBE2C decreases the stability of p53. The degradation rates of p53 were calculated and shown by curves. Data are mean ± SEM of three independent experiments. *, P < 0.05; **, P < 0.01 D, The half-life of p53 in endometrial cancer cells transfected with UBE2C is prolonged by MG132 treatment. E, UBE2C promotes ubiquitination and degradation of p53. Ishikawa and KLE cells were transfected with empty vector, UBE2C shRNAs, or UBE2C plasmid. After 36 hours, the cells were treated with MG132 (10 μmol/L) for 9 hours. The cells were harvested and lysed for immunoprecipitation using anti-p53 antibody. Anti-ubiquitin or anti-p53 antibody was used for Western blot analysis to determine the ubiquitination status of p53.
- Figure 4.
UBE2C promotes migration, invasion, and EMT of endometrial cancer by downregulating p53. A, p53 knockdown partially rescued the cell migration and invasion capacities of UBE2C-knockdown Ishikawa cells (magnification, 100×; mean ± SEM; n = 3; **, P < 0.01; ****, P < 0.0001). B, Overexpression of p53 significantly attenuated the cell migration and invasion capacities of UBE2C-overexpressing KLE cells (magnification, 100×; mean ± SEM; n = 3; *, P < 0.05; **, P < 0.01). C, The upregulation of E-cadherin and downregulation of vimentin caused by UBE2C knockdown were partially rescued by the transfection with p53-shRNA. D, The downregulation of E-cadherin and upregulation of vimentin caused by UBE2C were significantly inhibited by the ectopic p53 expression.
- Figure 5.
UBE2C expression is induced by E2 stimulation via ERα in endometrial cancer. A–C, Ishikawa, RL95-2, and HEC-1B cells were treated with different concentration of E2 for 24 hours, the expression of UBE2C in RL95-2 and Ishikawa cell lines increased in a concentration-dependent manner, the greatest effect of UBE2C upregulation occurred at 100 nmol/L E2 in Ishikawa and RL95-2 cells, but there was no significant change in HEC-1B cells. D and E, The increased expression levels of UBE2C protein induced by E2 were blocked by the ER blocker, ICI182780, in Ishikawa and RL95-2 cells. F, The expression of UBE2C was increased after E2 stimulation for 48 hours in the ESR1 overexpressing HEC-1B cells. G, The JASPAR program was employed to seek the binding site of ERα in the promoter region of UBE2C. H, Schematic of UBE2C gene promoter. Row 1, control, pGL3-basic; row 2, the WT (GAGACAGGTCTCCCTATCCT) binding site of UBE2C promoter region was subcloned into pGL3 luciferase reporter vector; and row 3, the mutant (GAGACAGGTCACTCAATCCT) binding site of UBE2C promoter region was subcloned into pGL3 luciferase reporter vector. I, The cells were transfected with control, the WT or mutant reporter plasmid, and pRL-TK plasmid, and treated with DMSO or E2. After 24 hours, the dual luciferase assay was performed to analyze the luciferase activities of each group (mean ± SEM; n = 3; ****, P < 0.0001).
- Figure 6.
E2 promotes cell migration, invasion, and EMT by upregulating UBE2C in vitro and in vivo. A and B, Control and UBE2C-silenced Ishikawa and RL95-2 cells were cultured with or without E2 (100 nmol/L) for 24 hours. Transwell assays indicated that E2 increased cell migration and invasion, and silencing UBE2C restricted the stimulatory effect of E2 on cell migration and invasion (magnification, 100 ×). Representative data and statistical analyses were shown (mean ± SEM; n = 3; *, P < 0.05; **, P < 0.01; ***, P < 0.001). C and D, E2 resulted in the elevation of vimentin levels and reduction of E-cadherin and p53 levels, and UBE2C downregulation reversed these E2-induced effects. E, Mice were injected with Ishikawa cells transfected with shNC or shUBE2C-4 and subcutaneously injected with or without estrogen (500 μg/kg) once a week (n = 5 mice/group, the animals were randomly distributed). The weight of xenograft tumors was measured (mean ± SEM; n = 5; *, P < 0.05; **, P < 0.01; ***, P < 0.001). F, The IHC analysis of E-cadherin and vimentin in xenograft tumors (original magnification, 400 ×). Representative images were shown. Scale bar, 50 μm.
- Figure 7.
Schematic model of E2/ERα-mediated UBE2C and p53 expression in endometrial cancer cells.
Additional Files
Supplementary Data
- Supplementary Figure S1 - p53 mutation analysis in exons 5-8 of cell lines.
- Supplementary Figure S2 - UBE2C promotes cell proliferation, migration, invasion, and EMT in RL95-2 cells.
- Supplementary Figure S3 - UBE2C negatively regulates the p53 tumor suppressor in RL95-2 cells.
- Supplementary Figure S4 - UBE2C positively correlates with ERα expression in endometrial cancer tissue samples and cell lines.
- Supplementary Figure S5 - UBE2C mRNA expression is induced by E2 stimulation in EC cell lines.
- Supplementary Materials and Methods - This file shows supplementary materials and methods
Volume 18, Issue 2
