Advertisement
Oncogenes and Tumor Suppressors

Modulation of Mutant KrasG12D-Driven Lung Tumorigenesis In Vivo by Gain or Loss of PCDH7 Function

Xiaorong Zhou, Mahesh S. Padanad, Bret M. Evers, Bethany Smith, Nicole Novaresi, Shruthy Suresh, James A. Richardson, Emily Stein, Jingfei Zhu, Robert E. Hammer and Kathryn A. O'Donnell
DOI: 10.1158/1541-7786.MCR-18-0739 Published February 2019

Abstract

PROTOCADHERIN 7 (PCDH7), a transmembrane receptor and member of the Cadherin superfamily, is frequently overexpressed in lung adenocarcinoma and is associated with poor clinical outcome. Although PCDH7 was recently shown to promote transformation and facilitate brain metastasis in lung and breast cancers, decreased PCDH7 expression has also been documented in colorectal, gastric, and invasive bladder cancers. These data suggest context-dependent functions for PCDH7 in distinct tumor types. Given that PCDH7 is a potentially targetable molecule on the surface of cancer cells, further investigation of its role in tumorigenesis in vivo is needed to evaluate the therapeutic potential of its inhibition. Here, we report the analysis of novel PCDH7 gain- and loss-of-function mouse models and provide compelling evidence that this cell-surface protein acts as a potent lung cancer driver. Employing a Cre-inducible transgenic allele, we demonstrated that enforced PCDH7 expression significantly accelerates KrasG12D-driven lung tumorigenesis and potentiates MAPK pathway activation. Furthermore, we performed in vivo somatic genome editing with CRISPR/Cas9 in KrasLSL-G12D; Tp53fl/fl (KP) mice to assess the consequences of PCDH7 loss of function. Inactivation of PCDH7 in KP mice significantly reduced lung tumor development, prolonged survival, and diminished phospho-activation of ERK1/2. Together, these findings establish a critical oncogenic function for PCDH7 in vivo and highlight the therapeutic potential of PCDH7 inhibition for lung cancer. Moreover, given recent reports of elevated or reduced PCDH7 in distinct tumor types, the new inducible transgenic model described here provides a robust experimental system for broadly elucidating the effects of PCDH7 overexpression in vivo.

Implications: In this study, we establish a critical oncogenic function for PCDH7 in vivo using novel mouse models and CRISPR/Cas9 genome editing, and we validate the therapeutic potential of PCDH7 inhibition for lung cancer.

This article is featured in Highlights of This Issue, p. 335

Introduction

Protocadherins (PCDH) are transmembrane proteins and members of the Cadherin superfamily that play well-established roles in cell adhesion and regulation of downstream signaling pathways (1, 2). A growing body of evidence has demonstrated that PCDH expression is dysregulated in tumorigenesis (3–7). Both oncogenic and tumor-suppressive roles have been assigned to PCDHs. However, the roles of individual PCDHs in cancer and the mechanisms through which their gain-of-function and loss-of-function drive tumorigenesis in vivo remain poorly understood. We previously reported that PROTOCADHERIN 7 (PCDH7) is frequently overexpressed in human non–small cell lung cancer (NSCLC) tumors (8). Moreover, high expression of PCDH7 was associated with poor clinical outcome of patients with lung adenocarcinoma. Although PCDH7 was recently shown to mediate brain metastasis in breast and lung cancers (9–12), decreased PCDH7 expression has been documented in colorectal, gastric, and invasive bladder cancers (13–15). Collectively, these data suggest context-dependent functions for PCDH7 in distinct tumor types. Because this molecule is a cell-surface receptor that is potentially accessible to antibody-based therapies, rigorous in vivo studies are needed to interrogate PCDH7 function in cancer pathogenesis.

Lung cancer is the leading cause of cancer-associated deaths worldwide (16). Given the limited effectiveness of current treatments, there is a critical need to identify new therapeutic targets. PCDH7 transforms human bronchial epithelial cells (HBEC) and synergizes with KRAS to induce MAPK signaling and tumorigenesis in immunocompromised mice (8). One mechanism through which PCDH7 potentiates ERK signaling is by facilitating interaction of Protein Phosphatase 2A (PP2A) with its potent inhibitor, the SET oncoprotein, thereby suppressing PP2A activity (8). Depletion of PCDH7 suppressed ERK activation, sensitized NSCLC cells to MEK inhibitors, and reduced growth of lung cancer cells in xenograft assays. Nevertheless, all prior studies of PCDH7 function in cancer utilized established cell lines. Thus, investigation of the oncogenic activity of PCDH7 in vivo using autochthonous tumor models, which more accurately model multistage tumor progression and the role of the tumor microenvironment, is needed to dissect the role of this cell-surface receptor in cancer pathogenesis and to evaluate the therapeutic potential of PCDH7 inhibition for non–small cell lung cancer.

In this study, we sought to establish the importance of PCDH7 in KrasG12D-driven lung cancer pathogenesis. To examine the effects of PCDH7 upregulation in lung tumor initiation and progression, we generated an inducible PCDH7 transgenic mouse model, allowing the demonstration that hyperactivity of PCDH7 promoted lung tumorigenesis and induced MAPK pathway activation in KrasLSL-G12D-mutant mice (17). In addition, to validate PCDH7 as a therapeutic target, we performed in vivo somatic gene editing in KrasLSL-G12D; Tp53fl/fl (KP) mice (18). Somatic depletion of PCDH7 in KP mice with CRISPR/Cas9 significantly reduced lung tumor development and prolonged survival, suggesting that targeting PCDH7 may benefit patients with lung adenocarcinoma. Interrogation of downstream signaling pathways revealed diminished phospho-ERK1/2 and phospho-RB in PCDH7 knockout tumors. These findings demonstrate a key oncogenic role for PCDH7 in vivo, supporting the potential therapeutic efficacy of PCDH7 inhibition for patients with lung cancer.

Materials and Methods

Constructs

Human PCDH7 isoform-A (NM_002589.2) cDNA was cloned into the CTV vector (Addgene #15912). The resulting CTV-PCDH7 was used to generate transgenic mice. Depletion of PCDH7 in vitro was performed by using Lenti-CRISPR-V2 (Addgene #52961) to introduce Cas9 and sgRNA directed against Pcdh7. Depletion of mouse Pcdh7 in vivo was performed using pSECC (Addgene #60820). The sgRNAs are as follows: human PCDH7, CGACGTCCGCATCGGCAACG; Mouse Pcdh7, GAGGATGCGGACCACGGGAT; human nonspecific control, CGCTTCCGCGGCCCGTTCAA; mouse nonspecific control, GCGAGGTATTCGGCTCCGCG. Human KrasG12V cDNA was cloned into pLenti CMV Hygro DEST (Addgene #17454) for ectopic expression of KrasG12V in HBECs. The human PCDH7 isoform-A cDNA was cloned into pLX303 lentivirus vector (Addgene #25897) for PCDH7 overexpression in vitro.

Mice

Generation and genotyping of PCDH7 transgenic mice.

PCDH7 transgenic mice were generated by UTSW transgenic core facility, through microinjection of the linearized CTV-PCDH7 vectors into the pronuclei of fertilized eggs (C57BL/6J strain). For genotyping of PCDH7 transgenic mice, genomic DNA was isolated from tail clippings using the Gentra Puregene Tissue Kit (Qiagen) according to the manufacturer's protocol. PCR was performed using 10–100 ng of genomic DNA as template and the following transgene specific primers: forward, 5′-TCCCCAGTCACCAACTGCAGGAAAAAAACACCAG-3′ reverse, 5′-GAATAGGAACTTCGGTACCGAATTGATCGCG-3′ (amplicon = 299 bp). Thermal cycling conditions using GoTaq Green Master Mix (Promega) were as follows: initial denaturation at 95°C for 5 minutes, followed by 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, in a total of 35 cycles, followed by a final extension at 72°C for 5 minutes. The samples were stored at 4°C until separated on a 1.2% (wt/vol) agarose gel.

B6.129S4-Krastm4Tyj/J mice, also known as KrasLSL-G12D mice were purchased from The Jackson Laboratory (008179). KrasLSL-G12D; PCDH7LSL/LSL (maintained on a B6 genetic background) were established by breeding KrasLSL-G12D with PCDH7LSL mice. KP mice (maintained on a FVB/B6 mixed genetic background) were provided by James Kim (UT Southwestern Medical Center, Dallas, TX). Immunocompromised mice NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG mice, 005557) were purchased from The Jackson Laboratories. CAG-Cre mice (19) were provided by Eric Olson (UT Southwestern Medical Center, Dallas, TX).

Ethics statement

Mice were monitored closely throughout all experimental protocols to minimize discomfort, distress, or pain. Signs of pain and distress include disheveled fur, decreased feeding, significant weight loss (>20% body mass), limited movement, or abnormal gait. If any of these signs were detected, the animal was removed from the study immediately and euthanized. All sacrificed animals were euthanized with CO2. The animals were placed in a clear chamber and 100% CO2 was introduced. Animals were left in the container until clinical death ensured. To ensure death prior to disposal, cervical dislocation was performed while the animal was still under CO2 narcosis. All methods were performed in accordance with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association and protocols approved by the UT Southwestern Institutional Animal Care and Use Committee (protocol # 2017-102112).

Tissue collection and IHC

Mice were euthanized by intraperitoneal administration of an overdose of Avertin at the time points indicated. Lungs were inflated and perfused through the trachea with 4% paraformaldehyde (PFA), fixed overnight, transferred to 50% ethanol and subsequently embedded in paraffin. Sections were cut and stained with hematoxylin and eosin (H&E) by the UT Southwestern Histology Core, which also provided assistance with the histopathologic examination. For IHC staining, slides were deparaffinized and treated with Antigen Unmasking Solution (Vector Laboratories, H-3300), blocked with BLOXALL Blocking Solution (Vector Laboratories, SP-6000), and then incubated with anti-Ki67 (CST #9027, 1:400) or anti-pERK (CST #9101S, 1:200) at 4°C overnight. After washing extensively, slides were incubated with SignalStain Boost Detection Reagent from Cell Signaling Technology (Rabbit #8114) at room temperature for 30 minutes. The signal was developed with ImmPACT DAB Substrate (Vector Laboratories, SK-4105), and sections were counterstained with hematoxylin (Vector Laboratories, H-3404), and mounted with VectaMount Mounting Reagent (Vector Laboratories, H-5000). All pictures were obtained using a Zeiss microscope (Observer.Z1) with an Axiocam-MRC camera.

Ki67 and pERK1/2 index.

Ki67-positive and pERK1/2 staining was distinguished by counting brown nuclei and hematoxylin (blue) counterstain. The Ki67 and pERK1/2 index for each mouse was calculated as follows: percent positive cells = number of positive nuclei/total cell nuclei × 100, as described previously (20). For Ki67 quantification, n = 2–4 animals/group were analyzed, and up to 10 independent fields/animal were quantified. For pERK1/2 quantification, 2 to 3 animals/group were analyzed, and 6 to 10 independent fields were quantified/animal.

Tumor burden analysis

For tumor quantification (Figs. 1C and 2D), the total tumor number for each animal was determined by analyzing H&E-stained sections and categorizing tumors into different stages [including atypical adenomatous hyperplasia (AAH), bronchiolar hyperplasia (BH), adenomas, and adenocarcinomas]. Five lobes per animal (one section per lobe) were quantified and 5–6 animals were analyzed per group.

Figure 1.
Figure 1.

PCDH7 accelerates lung tumorigenesis in the KrasLSL-G12D model. A, Schematic depicting the PCDH7LSL and KrasLSL-G12D transgenes and overview of experimental design. To induce lung tumors, KrasLSL-G12D; PCDH7LSL/LSL or control KrasLSL-G12D mice were infected with Adeno-Cre through intratracheal administration. B, H&E staining of lung lobes harvested at 16 and 20 weeks postinfection. Five independent lobes from one animal of each genotype are shown. C, Tumor burden analysis at 16 and 20 weeks postinfection. n = 5–6 mice/group, 5 sections/mouse analyzed. Tumors were counted and classified into AAH/BH, adenomas, or adenocarcinomas. D, Weight of lungs collected from KrasLSL-G12D; PCDH7LSL/LSL or KrasLSL-G12D mice at 20 weeks postinfection. IHC staining of Ki67 at 20 weeks (E) and quantification of Ki67 index for lung sections harvested from KrasLSL-G12D; PCDH7LSL/LSL or control KrasLSL-G12D mice at 16 and 20 weeks postinfection (F); n = 2–4 mice/group, up to 10 fields quantified/animal. G, IHC staining of pERK1/2 for lung sections from KrasLSL-G12D; PCDH7LSL/LSL or control KrasLSL-G12D mice at 16 weeks postinfection. H, Quantification of p-ERK1/2 IHC staining at 16 and 20 weeks postinfection. n = 2 mice/group, 7 fields quantified/animal.

Figure 2.
Figure 2.

In vivo inactivation of Pcdh7 reduces lung tumor burden and prolongs survival of KP mice. A, Schematic of in vivo CRISPR/Cas9 editing. KP mice were infected with a sg-control or sg-Pcdh7 through intratracheal administration of pSECC lentivirus expressing Cas9 and Cre. B, Survival analysis of KP mice infected with sg-control or sg-Pcdh7 lentivirus. C, H&E staining of lung lobes harvested at 10 weeks postinfection. D, Tumor burden analysis at 10 weeks postinfection. Tumors were counted and classified into AAH, BH, or adenomas based on histopathologic analysis. n = 5–7 animals/group, 5 lobes/animal, 1 section/lobe analyzed. E, Total tumor area (inches2) at 10 weeks postinfection based on histopathologic analysis of lung sections using the NIH ImageJ program. F, Percent tumor area compared with total area of lung lobes at 10 weeks postinfection (determined using NIH Image J). G, H&E staining of lung lobes harvested at 20 weeks postinfection. H, Total tumor area (inches2) at 20 weeks postinfection based on histopathologic analysis of lung sections. I, Percent tumor area compared with total area of lung lobes at 20 weeks postinfection.

To analyze tumor burden of CRISPR/Cas9–targeted mice, tumor number (as described above) and tumor area was quantified. Total tumor area was determined by analyzing H&E–stained sections using the NIH Image J Program (five lobes per animal, one section per lobe, n = 5–7 animals/group). The average tumor area (inches2) and percent of tumor versus total lung area are shown (Fig. 2E–F and H–I).

TUNEL staining and quantification

TUNEL staining was performed using DeadEND Fluorometric TUNEL System (Promega, Part # TB235) following the manufacturer's guidelines. Paraffin embedded tissue sections were deparaffinized. After washing in PBS for 5 minutes, tissue sections were fixed in 4% formaldehyde in PBS for 15 minutes. Slides were washed twice in PBS for 5 minutes each and subjected to permeabilization by adding 100 μL of a 20 μg/mL Proteinase K solution diluted in PBS for 10 minutes at room temperature. Tissue sections were washed in PBS for 5 minutes, refixed by immersing in 4% formaldehyde in PBS for 5 minutes, and washed again in PBS for 5 minutes. Tissue sections were equilibrated with100 μL of equilibration buffer at room temperature for 10 minutes, labeled by adding 50 μL of TdT reaction mix, and incubated for 60 minutes at 37°C in a humidified chamber in a dark container to avoid exposure to light. The reaction was stopped by immersing the slides in 2X SSC for 15 minutes and washed three times in PBS for 5 minutes each. The slides were counterstained and mounted with Vectashield hard set mounting media with DAPI (H-1500). Localized green fluorescent apoptotic cells in tissue sections were detected and images were captured using a ZEISS confocal fluorescence microscope LSM-800. The TUNEL score was calculated by counting all the positive- and negative-stained tumor cells within a given field of view. Percent TUNEL-positive nuclei were calculated by dividing the number of positive nuclei by the total number of cell nuclei × 100. Fifteen independent fields were quantified for each animal and 2 to 4 animals per group were analyzed.

Cell culture

Immortalized normal HBECs with stable knockdown of TP53 with shRNA (HBEC-shp53) were provided by John Minna at UT Southwestern Medical Center, Dallas, TX (21–23). Ectopic expression of KRASG12V in HBEC-shp53 was performed with lentiviral infection followed by selection with hygromycin B for 7 days. HBEC-shp53-PCDH7 or HBEC-shp53-KRASG12V-PCDH7 cells were established with the pLX303-PCDH7 lentivirus followed by selection with blasticidin for 10 days. All HBECs were cultured in keratinocyte serum–free medium (KSFM; Life Technologies Inc.) containing 50 μg/mL of bovine pituitary extract (BPE; Life Technologies, Inc.) and 5 ng/mL of EGF (Life Technologies, Inc.). Human lung adenocarcinoma H1944 cells were cultured in RPMI1640 media supplemented with 10% FBS (Life Technologies, Inc.), 100 U/mL of penicillin and streptomycin (Life Technologies, Inc.). PCDH7 depletion in H1944 cells was achieved using Lenti-CRISPRv2 followed by selection with puromycin for 7 days (1 μg/mL). All cell lines used in this study were cultured in 5% CO2 at 37°C, tested negative for mycoplasma contamination, and were authenticated in 2016 with the PowerPlex 1.2 Kit (Promega).

Virus preparation, titration, and intratracheal administration

Cre-expressing adenovirus (Adeno-Cre) was purchased from Viral Vector Core Facility (University of Iowa, Iowa City, IA). The PCDH7LSL and KrasLSL-G12D transgenes were induced with intratracheal administration of Adenovirus-Cre (Adeno-Cre, 2 × 107 IFU/mouse; ref. 24).

Pcdh7 sgRNA-1 (sg-Pcdh7) or a nonspecific control sgRNA (sg-control) were cloned into pSECC lentiviral vectors, packaged, and titered with Green-Go cells as described previously (18). Lentiviruses were produced by cotransfection of 293T cells with lentiviral backbone constructs and packaging vectors (psPAX2 and pMD2.G) using Lipofectamine 3000 (Invitrogen). Supernatants were collected 72 hours posttransfection, concentrated by ultracentrifugation at 25,000 rpm for 120 minutes, and resuspended in an appropriate volume of Opti-MEM (Gibco). Green-Go cells, which were generated by transducing retrovirus containing an inverted GFP (flanked by two sets of incompatible loxP sites), were provided by Tyler Jacks (Massachusetts Institute of Technology, Cambridge, MA), and maintained in DMEM supplemented with 10% FBS and gentamicin (18). Upon infection with pSECC lentivirus, Green-Go cells become GFP+, allowing for titering by FACS. Briefly, 2 × 104 Green-Go cells were seeded into each well of 24-well plates and incubated overnight. The next day, cells were infected with 20 μL, 10 μL, 5 μL, or 2 μL pSECC lentivirus. At 48 hours postinfection, cells were collected and GFP+ cells were quantified by FACS. The titer of pSECC lentivirus is designated as the average number of GFP+ cells in the four groups. Intratracheal administration of pSECC lentivirus was performed according to established protocols (24). A total of 4 × 104 virus/mouse was administered for survival analysis and 2 × 105 virus/mouse was administered for tumor burden analysis at 10 and 20 weeks postinfection (24).

siRNA knockdown

PCDH7 siRNA (Accell SMARTpool) or nonspecific control siRNA were purchased from Dharmacon. HBECs were incubated in Accell Delivery Media (Dharmacon) in 6-well plates overnight to reach 50% confluence, and siRNAs diluted in siRNA Buffer (Dharmacon) were added at final concentration of 1 μmol/L. Seventy-two hours after transfection, cells were collected and gene expression was assessed by Western blot analysis.

Western blot analysis

Protein lysates were prepared with RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific, 89900) including Halt Protease Inhibitor Cocktail, EDTA-free diluted 1:100. Protein concentrations were determined by BCA Assay (Thermo Fisher Scientific, 23228 and 23224). A total of 25 to 30 μg of each protein lysate was loaded into each well of a Bolt 4%–12% Bis-Tris Plus Gels (Life Technologies, NW04120BOX), electrophoresed, and transferred to nitrocellulose using iBlot2 Western Blotting System (Life Technologies). The primary antibodies (1:1,000 dilution) for Western blot analysis are as follows: PCDH7 (Abcam, ab139274), pERK (Cell Signaling Technology, # 9101S), total ERK (Cell Signaling Technology #4695), pRb (Ser807/811, Cell Signaling Technology #8516), total Rb (Cell Signaling Technology #9309), and β-ACTIN (Cell Signaling Technology #4970). Horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibodies (1:5,000–20,000 dilution; Bio-Rad) were used and signals developed with the SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific, 34075), according to the manufacturer's instructions.

Verification of gene editing

To detect CRISPR-induced indels, tumors from a sg-Pcdh7 mouse (20 weeks after infection) were dissected and surrounding lung tissues carefully removed. Tumor tissues were homogenized and genomic DNA (gDNA) was isolated using the Gentra Puregene Tissue Kit (Qiagen). To amplify the Pcdh7 sgRNA–targeted region, PCR was performed with tumor gDNA using PrimeSTAR HS DNA Polymerase (Clontech). The products were gel purified and cloned into the Zero Blunt TOPO sequencing vector (Invitrogen). At least eight colonies for each tumor were sequenced.

Statistical analysis

All statistical analyses were performed using GraphPad Prism for Windows. Quantitative variables were analyzed by Student t test, Fisher exact test, or χ2 test. All statistical analyses were two sided, and P < 0.05 was considered statistically significant.

Results

PCDH7 accelerates lung tumorigenesis in a mouse model of KrasG12D-driven lung adenocarcinoma

To assess the oncogenic activity of PCDH7 in vivo and to investigate the mechanisms underlying PCDH7-mediated transformation, we generated a transgenic mouse model that allows precise control of PCDH7 expression through Cre-mediated recombination. We selected human PCDH7 isoform A, which is the predominant isoform expressed in human lung cancer cell lines from the Cancer Cell Line Encyclopedia and a panel of NSCLC cell lines (8, 25). The transgene is depicted in Fig. 1A. A LoxP-Stop-LoxP (LSL) cassette allows control with Cre-recombinase. After removal of the LSL cassette, the CAG promoter drives expression of human PCDH7 and green fluorescent protein (GFP). To validate inducible expression of the transgene, PCDH7LSL mice were crossed to CAG-Cre mice that ubiquitously express Cre recombinase (Supplementary Fig. S1A). Cre-dependent transgene activation was confirmed in lung tissue using qRT-PCR and Western blot analysis (Supplementary Fig. S1A–S1C).

Replication-deficient viruses have been widely used to deliver Cre to the lung, thereby activating a mutant Kras allele to generate sporadic lung tumors in KrasLSL-G12D mice (17, 26–28). To determine whether enforced expression of PCDH7 is sufficient to accelerate KrasG12D-mediated lung tumorigenesis in vivo, we bred PCDH7LSL mice with KrasLSL-G12D mice and induced both transgenes via intratracheal administration of Adenovirus-Cre (Fig. 1A; 24). Tumors were detectable in all lobes at 16 and 20 weeks postinfection (Fig. 1B). At 16 weeks postinfection, the majority of tumors were early stage and categorized as AAH or BH (Supplementary Fig. S1D; Fig. 1C; refs. 17, 18, 24). KrasLSL-G12D; PCDH7LSL/LSL mice exhibited a significant increase in AAH and BH tumors compared with KrasLSL-G12D mice. KrasLSL-G12D; PCDH7LSL/LSL mice also developed more adenomas than KrasLSL-G12D mice, indicating accelerated disease progression. At 20 weeks postinfection, tumor burden was significantly higher in KrasLSL-G12D; PCDH7LSL/LSL mice than in KrasLSL-G12D mice, as determined by quantifying tumor numbers at different stages (Fig. 1C) and lung weight (Fig. 1D; Supplementary Fig. S1E). No tumors were observed in PCDH7LSL/LSL mice after 16 months postinfection, suggesting that isolated expression of the transgene is not sufficient to initiate tumorigenesis by this time point.

PCDH7 cooperates with oncogenic KRAS to promote ERK activation and cell proliferation in HBECs; ref. 8). Consistent with these effects, tumors from KrasLSL-G12D; PCDH7LSL/LSL mice exhibited greater numbers of Ki67 and pERK1/2-positive cells compared with tumors from KrasLSL-G12D mice (Fig. 1E–H). Moreover, the apoptotic index as measured by quantification of TUNEL staining, was significantly lower in tumors from KrasLSL-G12D; PCDH7LSL/LSL mice (Supplementary Fig. S2A and S2B). Taken together, these data support a protumorigenic role for PCDH7 in KrasG12D-mutant lung cancer and demonstrate that PCDH7 modulates MAPK pathway activity in vivo.

In vivo inactivation of Pcdh7 reduces lung tumor burden and prolongs survival of KP mice

Inhibition of PCDH7 reduced tumorigenesis of KRAS-mutant NSCLC cells in xenograft assays (8). However, xenografts do not fully recapitulate all aspects of tumorigenesis, including contributions from the microenvironment and immune system. Therefore, examination of in vivo loss-of-function is critical to establish whether PCDH7 represents a potential therapeutic target in NSCLC. We took advantage of a recently described in vivo somatic genome editing approach to rapidly interrogate PCDH7 function in KP mice (Fig. 2A; ref. 18). Interestingly, PCDH7 is upregulated in KP tumors relative normal lung, suggesting it may act as an oncogenic driver in this context (Supplementary Fig. S3A). CRISPR/Cas9–based gene editing efficiently produces loss-of-function mutations in this model, which result in phenotypes that closely mirror those observed following traditional germline gene-targeting approaches.

To identify an optimal Pcdh7 single-guide (sgRNA) for in vivo studies, immortalized mouse embryonic fibroblasts were infected with a lentivirus expressing the Cas9 nuclease and a control sgRNA or one of five sgRNAs directed against murine Pcdh7 (Fig. 2A; ref. 29). Pcdh7 sgRNA-1 most dramatically diminished PCDH7 expression by Western blot analysis (Supplementary Fig. S3B). CRISPR/Cas9–induced double-strand DNA breaks were verified with the SURVEYOR assay (Supplementary Fig. S3C; ref. 30), thus Pcdh7 sgRNA-1 was selected for in vivo targeting.

KP mice were infected with pSECC-sg-control or pSECC-sg-Pcdh7 lentiviruses through intratracheal administration, following established protocols (24). Because the lentivirus expresses Cas9 and Cre, the Pcdh7 sgRNA generates mutations in the same lung cells that undergo activation of the KrasLSL-G12D allele and deletion of theTp53fl/fl allele. Somatic mutation of Pcdh7 prolonged survival of KP mice (Fig. 2B). At an early time point (10 weeks after infection), we observed fewer adenomas but not AAH or BH lesions in Pcdh7-targeted KP lungs (Fig. 2C and D) and decreased overall tumor area (Fig. 2E and F). Moreover, at 20 weeks postinfection, a time point associated with robust adenocarcinoma formation in KP mice, we documented significantly reduced tumor burden (Fig. 2G–I).

Given recent studies documenting a role for PCDH7 in metastasis, we assessed invasive properties of tumors in these mice. We observed evidence of micro- and macrometastases, lymphovascular invasion, and intravascular tumor spreading in control-treated KP mice (Supplementary Fig. S4). sg-Pcdh7–treated mice exhibited a lower incidence of these malignant features and a higher incidence of relatively benign neoplastic lesions, including AAH and adenomas. Thus, Pcdh7 depletion reduced tumor invasiveness in vivo.

To verify gene-editing events, genomic DNA was harvested from Pcdh7-targeted tumors at 20 weeks after infection, mutations in the sgRNA-targeted region of Pcdh7 were sequenced, and PCDH7 expression was measured by Western blotting. All control tumors from KP mice expressed high levels of PCDH7 relative to normal lung tissue (Fig. 3A). As expected, tumors isolated from sg-Pcdh7–targeted KP mice exhibited diminished PCDH7 expression to varying degrees across analyzed tumors (Fig. 3A; Supplementary Fig. S5A). Accordingly, sequencing of the sg-Pcdh7–targeted region revealed homozygous or heterozygous deletions resulting in a frameshift in 8 of 9 tumors analyzed, with residual wild-type or in-frame alleles in tumors with higher PCDH7 expression (Supplementary Fig. S5B).

Figure 3.
Figure 3.

Somatic knockout of Pcdh7 inhibits proliferation and reduces MAPK signaling in KP mice. A, Western blot analysis of PCDH7, pERK1/2, and total ERK in normal lung tissues from uninfected KP mice, and lung tumors from KP mice infected with sg-control or sg-Pcdh7 lentivirus (20 weeks postinfection). Left, Ki67 IHC staining of lung sections harvested from KP mice infected with sg-control or sg-Pcdh7 lentivirus at 10 weeks (B) or 20 weeks (C) postinfection. Right, Ki67 index = percent of cells with a Ki67-positive signal / total cell number in each field. n = 3 animals/group. D, pERK1/2 IHC staining of lung lobes from KP mice infected with sg-control or sg-Pcdh7 lentivirus at 10 weeks postinfection. E, Quantification of p-ERK1/2 IHC staining (represented by percent of p-ERK1/2-positive cells) at 10 and 20 weeks postinfection. n = 2–3 animals/group, 6–10 fields quantified/animal. F, TUNEL staining of lung lobes from KP mice infected with sg-control or sg-Pcdh7 lentivirus at 10 weeks postinfection. G, Quantification of TUNEL index (represented by percent of TUNEL-positive cells) at 10 and 20 weeks postinfection. n = 2–3 animals/group, 15 independent fields quantified/animal.

Somatic knockout of Pcdh7 inhibits proliferation and reduces MAPK signaling in KP mice

To examine the effects of PCDH7 depletion on downstream signaling in vivo, we harvested tumors from KP mice infected with either sg-control or sg-Pcdh7 lentivirus and analyzed phospho-ERK1/2 and total ERK expression by Western blotting (Fig. 3A). Although phospho-ERK1/2 was uniformly lower in sg-Pcdh7–targeted tumors compared with control tumors, some heterogeneity existed, consistent with additional genetic events affecting the MAPK pathway. IHC demonstrated that pERK1/2 and Ki67 staining were reduced in tumors from sg-Pcdh7–targeted mice compared with control KP tumors (Fig. 3B–E), further supporting a role for PCDH7 in stimulating MAPK pathway activity. TUNEL staining was significantly increased in sg-Pcdh7–targeted mice, demonstrating that inhibition of Pcdh7 also promotes apoptosis (Fig. 3F and G).

PCDH7 modulates expression of PP2A targets

PCDH7 overexpression in HBECs impacts several important cancer-relevant pathways. One reported target of PP2A is pRB (31). Accordingly, the pRB pathway was previously identified as a significantly upregulated gene set in RNAseq analysis of HBEC-shp53-PCDH7 cells (P = 0; FDR q value = 2.35 × 10−4; ref. 8). To determine whether PCDH7 regulates the pRB pathway in the context of mutant KRASG12V, we generated HBEC-shp53 cells with enforced expression of mutant KRASG12V, PCDH7, or both in combination. Western blot analysis revealed that while KRASG12V increased pERK and pRB signaling, PCDH7 cooperated with KRASG12V to further enhance both pERK and pRB signaling (Fig. 4A). Furthermore, both pERK and pRB signaling were significantly reduced upon PCDH7 inhibition with siRNAs in shp53-KRASG12V-PCDH7 cells (Fig. 4B).

Figure 4.
Figure 4.

PCDH7 modulates expression of PP2A targets pERK1/2 and pRB. A, Western blot analysis of PCDH7, pERK, total ERK, pRb, and total RB levels in HBECs expressing KRASG12V, PCDH7, or both. B, PCDH7 inhibition with siRNAs in HBEC-shp53-KRASG12V-PCDH7 cells and its effects on pERK and pRb signaling, as indicated by Western blot analysis. C, Western blot analysis of PCDH7, pRB, and total RB expression in lung tumors harvested from KP mice with sg-control or sg-Pcdh7 lentivirus at 20 weeks postinfection. D, Quantification of pRB protein levels shown in C. E, Western blot analysis showing diminished pERK1/2 and pRB protein in human NSCLC H1944 xenografts with PCDH7 sgRNA.

To determine the extent to which PCDH7 inhibition impacts the RB pathway in vivo, sg-control or sg-Pcdh7–treated tumors from KP mice were collected at 20 weeks postinfection, and pRB and total RB were examined by Western blotting. A minor, but significant, decrease in pRB signaling was observed in PCDH7-depleted tumors compared with control tumors (Fig. 4C and D). Finally, we extended these studies to human NSCLC xenografts. In KRAS-mutant H1944 lung adenocarcinoma cells, CRISPR/Cas9–mediated depletion of PCDH7 suppressed the growth of xenografts in immunocompromised NOD/SCID IL2Rγnull NSG mice (8). Western blotting demonstrated that PCDH7 depletion diminished both pRB and pERK signaling in vivo (Fig. 4E). Collectively, these data show that PCDH7 enhances phospho-activation of multiple PP2A targets including pERK1/2, and to a lesser extent pRB, in KRAS-mutant lung cancer cells.

Discussion

PCDH7 is an actionable therapeutic target in lung adenocarcinoma

The inducible PCDH7 transgenic mouse described here provides a valuable model for the evaluation of PCDH7 function in various tumorigenic contexts. Given the prior reports of elevated or reduced PCDH7 in distinct tumor types (8, 10, 13–15), the PCDH7LSL model, when combined with various tissue-specific Cre driver lines, provides a robust experimental system for elucidating the effects of PCDH7 overexpression in different in vivo settings. Furthermore, this animal model represents an ideal system for future testing of therapeutics directed at PCDH7, including mAbs.

We previously demonstrated that PCDH7 interacts with the PP2A phosphatase, and SET (a potent PP2A inhibitor), thereby inhibiting PP2A activity in HBECs and human NSCLC cells (8). PP2A loss-of-function results in aberrant phosphorylation of substrates in a variety of pathways linked to cancer, including the MAPK, RB, AKT, and JAK/STAT pathways (32–35). Our in vivo gain- and loss-of-function studies demonstrate that PCDH7 promotes ERK phospho-activation, an event known to initiate lung tumorigenesis and promote the rapid progression of adenomas to more invasive adenocarcinomas (36). Importantly, the magnitude and duration of ERK signaling are tightly controlled by regulators that provide negative feedback, including PP2A (37, 38). Moreover, the consequences of PCDH7-mediated PP2A inhibition likely extend beyond MAPK signaling. Indeed, we show here that PCDH7 modulates pRB levels in human NSCLC xenografts and, to a lesser extent, in KP mouse tumors. PCDH7 likely modulates other PP2A targets in addition to pERK and pRB. Taken together, our data establish PCDH7 as a cooperative oncogenic driver in KRAS-mutant lung cancer that functions to enhance protumorigenic signaling in cancer cells.

PCDH7 was recently shown to promote metastasis of lung and breast cancer cells (10, 39), further supporting the importance of this protein in multiple aspects of tumor biology. Consistent with these observations, our studies revealed that Pcdh7 depletion in KP mice reduced tumor invasiveness in vivo. Overall, the results reported here establish PCDH7 as an oncogenic driver of lung tumor initiation and progression in vivo, setting the stage for future efforts to target this cell-surface protein with novel therapeutic strategies in lung adenocarcinoma.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Authors' Contributions

Conception and design: X. Zhou, K.A. O’Donnell

Development of methodology: X. Zhou, S. Suresh

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): X. Zhou, M.S. Padanad, B. Smith, N. Novaresi, S. Suresh, J. Zhu, R.E. Hammer

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): X. Zhou, M.S. Padanad, B.M. Evers, J.A. Richardson, E. Stein, K.A. O’Donnell

Writing, review, and/or revision of the manuscript: X. Zhou, M.S. Padanad, B.M. Evers, S. Suresh, R.E. Hammer, K.A. O’Donnell

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): E. Stein

Study supervision: K.A. O’Donnell

Acknowledgments

The authors thank John Shelton at the University of Texas Southwestern Histology Core for assistance with histology, John Minna and Michael Peyton for sharing cell lines, and Tyler Jacks, David McFadden, James Kim, and Eric Olson for sharing reagents and mice. We also thank Joshua Mendell and members of the O’Donnell laboratory for critical reading of the manuscript. This work was supported by the NCI (R01 CA207763, to K.A. O’Donnell), the Sidney Kimmel Foundation (SKF-15-067, to K.A. O’Donnell), the Cancer Prevention Research Institute of Texas (CPRIT, R1101, and RP150676, to K.A. O’Donnell; RP140110 and RP160157, to S. Suresh), The Welch Foundation (I-1881-20180324, to K.A. O’Donnell), the LUNGevity Foundation (2015-03, to K.A. O’Donnell), and a SPORE in Lung Cancer CDA (P50CA70907-17). K.A. O’Donnell is a CPRIT Scholar in Cancer Research and a Kimmel Scholar. X. Zhou was supported by the Lung Cancer Research Foundation (LCRF 2015) and the National Natural Science Foundation of China (NSFC 81571527, 81771681).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

  • Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/).

  • Received July 12, 2018.
  • Revision received September 26, 2018.
  • Accepted October 30, 2018.
  • Published first November 8, 2018.

References

  1. 1.↵
    1. Kahr I,
    2. Vandepoele K,
    3. van Roy F
    . Delta-protocadherins in health and disease. Prog Mol Biol Transl Sci 2013;116:169–92.
    OpenUrl
  2. 2.↵
    1. Pan D
    . The hippo signaling pathway in development and cancer. Dev Cell 2010;19:491–505.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. van Roy F
    . Beyond E-cadherin: roles of other cadherin superfamily members in cancer. Nat Rev Cancer 2014;14:121–34.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Vincent A,
    2. Omura N,
    3. Hong SM,
    4. Jaffe A,
    5. Eshleman J,
    6. Goggins M
    . Genome-wide analysis of promoter methylation associated with gene expression profile in pancreatic adenocarcinoma. Clin Cancer Res 2011;17:4341–54.
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. Yang X,
    2. Chen MW,
    3. Terry S,
    4. Vacherot F,
    5. Chopin DK,
    6. Bemis DL,
    7. et al.
    A human- and male-specific protocadherin that acts through the wnt signaling pathway to induce neuroendocrine transdifferentiation of prostate cancer cells. Cancer Res 2005;65:5263–71.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    1. Yu B,
    2. Yang H,
    3. Zhang C,
    4. Wu Q,
    5. Shao Y,
    6. Zhang J,
    7. et al.
    High-resolution melting analysis of PCDH10 methylation levels in gastric, colorectal and pancreatic cancers. Neoplasma 2010;57:247–52.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Yu JS,
    2. Koujak S,
    3. Nagase S,
    4. Li CM,
    5. Su T,
    6. Wang X,
    7. et al.
    PCDH8, the human homolog of PAPC, is a candidate tumor suppressor of breast cancer. Oncogene 2008;27:4657–65.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Zhou X,
    2. Updegraff BL,
    3. Guo Y,
    4. Peyton M,
    5. Girard L,
    6. Larsen JE,
    7. et al.
    PROTOCADHERIN 7 acts through SET and PP2A to potentiate MAPK signaling by EGFR and KRAS during lung tumorigenesis. Cancer Res 2017;77:187–97.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Bos PD,
    2. Zhang XH,
    3. Nadal C,
    4. Shu W,
    5. Gomis RR,
    6. Nguyen DX,
    7. et al.
    Genes that mediate breast cancer metastasis to the brain. Nature 2009;459:1005–9.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Chen Q,
    2. Boire A,
    3. Jin X,
    4. Valiente M,
    5. Er EE,
    6. Lopez-Soto A,
    7. et al.
    Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer. Nature 2016;533:493–8.
    OpenUrlCrossRef
  11. 11.↵
    1. Li AM,
    2. Tian AX,
    3. Zhang RX,
    4. Ge J,
    5. Sun X,
    6. Cao XC
    . Protocadherin-7 induces bone metastasis of breast cancer. Biochem Biophys Res Commun 2013;436:486–90.
    OpenUrlCrossRefPubMed
  12. 12.↵
    1. Valiente M,
    2. Obenauf AC,
    3. Jin X,
    4. Chen Q,
    5. Zhang XH,
    6. Lee DJ,
    7. et al.
    Serpins promote cancer cell survival and vascular co-option in brain metastasis. Cell 2014;156:1002–16.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Bujko M,
    2. Kober P,
    3. Mikula M,
    4. Ligaj M,
    5. Ostrowski J,
    6. Siedlecki JA
    . Expression changes of cell-cell adhesion-related genes in colorectal tumors. Oncol Lett 2015;9:2463–70.
    OpenUrl
  14. 14.↵
    1. Chen HF,
    2. Ma RR,
    3. He JY,
    4. Zhang H,
    5. Liu XL,
    6. Guo XY,
    7. et al.
    Protocadherin 7 inhibits cell migration and invasion through E-cadherin in gastric cancer. Tumour Biol 2017;39:1010428317697551.
    OpenUrl
  15. 15.↵
    1. Lin YL,
    2. Wang YL,
    3. Fu XL,
    4. Li WP,
    5. Wang YH,
    6. Ma JG
    . Low expression of protocadherin7 (PCDH7) is a potential prognostic biomarker for primary non-muscle invasive bladder cancer. Oncotarget 2016;7:28384–92.
    OpenUrl
  16. 16.↵
    1. Swanton C,
    2. Govindan R
    . Clinical implications of genomic discoveries in lung cancer. N Engl J Med 2016;374:1864–73.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Jackson EL,
    2. Willis N,
    3. Mercer K,
    4. Bronson RT,
    5. Crowley D,
    6. Montoya R,
    7. et al.
    Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev 2001;15:3243–8.
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Sanchez-Rivera FJ,
    2. Papagiannakopoulos T,
    3. Romero R,
    4. Tammela T,
    5. Bauer MR,
    6. Bhutkar A,
    7. et al.
    Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature 2014;516:428–31.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Sakai K,
    2. Miyazaki J
    . A transgenic mouse line that retains Cre recombinase activity in mature oocytes irrespective of the cre transgene transmission. Biochem Biophys Res Commun 1997;237:318–24.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Bologna-Molina R,
    2. Damian-Matsumura P,
    3. Molina-Frechero N
    . An easy cell counting method for immunohistochemistry that does not use an image analysis program. Histopathology 2011;59:801–3.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Ramirez RD,
    2. Sheridan S,
    3. Girard L,
    4. Sato M,
    5. Kim Y,
    6. Pollack J,
    7. et al.
    Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res 2004;64:9027–34.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Sato M,
    2. Larsen JE,
    3. Lee W,
    4. Sun H,
    5. Shames DS,
    6. Dalvi MP,
    7. et al.
    Human lung epithelial cells progressed to malignancy through specific oncogenic manipulations. Mol Cancer Res 2013;11:638–50.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Sato M,
    2. Vaughan MB,
    3. Girard L,
    4. Peyton M,
    5. Lee W,
    6. Shames DS,
    7. et al.
    Multiple oncogenic changes (K-RAS(V12), p53 knockdown, mutant EGFRs, p16 bypass, telomerase) are not sufficient to confer a full malignant phenotype on human bronchial epithelial cells. Cancer Res 2006;66:2116–28.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. DuPage M,
    2. Dooley AL,
    3. Jacks T
    . Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc 2009;4:1064–72.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Barretina J,
    2. Caponigro G,
    3. Stransky N,
    4. Venkatesan K,
    5. Margolin AA,
    6. Kim S,
    7. et al.
    The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 2012;483:603–7.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Jackson EL,
    2. Olive KP,
    3. Tuveson DA,
    4. Bronson R,
    5. Crowley D,
    6. Brown M,
    7. et al.
    The differential effects of mutant p53 alleles on advanced murine lung cancer. Cancer Res 2005;65:10280–8.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    1. Kumar MS,
    2. Erkeland SJ,
    3. Pester RE,
    4. Chen CY,
    5. Ebert MS,
    6. Sharp PA,
    7. et al.
    Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc Natl Acad Sci U S A 2008;105:3903–8.
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    1. Sutherland KD,
    2. Song JY,
    3. Kwon MC,
    4. Proost N,
    5. Zevenhoven J,
    6. Berns A
    . Multiple cells-of-origin of mutant K-Ras-induced mouse lung adenocarcinoma. Proc Natl Acad Sci U S A 2014;111:4952–7.
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    1. Sanjana NE,
    2. Shalem O,
    3. Zhang F
    . Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 2014;11:783–84.
    OpenUrlCrossRefPubMed
  30. 30.
    1. Ran FA,
    2. Hsu PD,
    3. Wright J,
    4. Agarwala V,
    5. Scott DA,
    6. Zhang F
    . Genome engineering using the CRISPR-Cas9 system. Nat Protoc 2013;8:2281–308.
    OpenUrlCrossRefPubMed
  31. 31.↵
    1. Magenta A,
    2. Fasanaro P,
    3. Romani S,
    4. Di Stefano V,
    5. Capogrossi MC,
    6. Martelli F
    . Protein phosphatase 2A subunit PR70 interacts with pRb and mediates its dephosphorylation. Mol Cell Biol 2008;28:873–82.
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    1. Kurimchak A,
    2. Grana X
    . PP2A: more than a reset switch to activate pRB proteins during the cell cycle and in response to signaling cues. Cell Cycle 2015;14:18–30.
    OpenUrlCrossRefPubMed
  33. 33.↵
    1. Perrotti D,
    2. Neviani P
    . Protein phosphatase 2A: a target for anticancer therapy. Lancet Oncol 2013;14:e229–38.
    OpenUrlCrossRefPubMed
  34. 34.↵
    1. Ross JA,
    2. Cheng H,
    3. Nagy ZS,
    4. Frost JA,
    5. Kirken RA
    . Protein phosphatase 2A regulates interleukin-2 receptor complex formation and JAK3/STAT5 activation. J Biol Chem 2010;285:3582–91.
    OpenUrlAbstract/FREE Full Text
  35. 35.↵
    1. Ruvolo PP
    . The broken "Off" switch in cancer signaling: PP2A as a regulator of tumorigenesis, drug resistance, and immune surveillance. BBA Clin 2016;6:87–99.
    OpenUrl
  36. 36.↵
    1. Cicchini M,
    2. Buza EL,
    3. Sagal KM,
    4. Gudiel AA,
    5. Durham AC,
    6. Feldser DM
    . Context-dependent effects of amplified MAPK signaling during lung adenocarcinoma initiation and progression. Cell Rep 2017;18:1958–69.
    OpenUrl
  37. 37.↵
    1. Kiely M,
    2. Kiely PA
    . PP2A: the wolf in sheep's clothing? Cancers 2015;7:648–69.
    OpenUrlCrossRef
  38. 38.↵
    1. Lake D,
    2. Correa SA,
    3. Muller J
    . Negative feedback regulation of the ERK1/2 MAPK pathway. Cell Mol Life Sci 2016;73:4397–413.
    OpenUrl
  39. 39.↵
    1. Ren D,
    2. Zhu X,
    3. Kong R,
    4. Zhao Z,
    5. Sheng J,
    6. Wang J,
    7. et al.
    Targeting brain-adaptive cancer stem cells prohibits brain metastatic colonization of triple-negative breast cancer. Cancer Res 2018;78:2052–64.
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top
View this article with LENS

Open full page PDF
Article Alerts
Email Article
Citation Tools
Modulation of Mutant KrasG12D-Driven Lung Tumorigenesis In Vivo by Gain or Loss of PCDH7 Function
Xiaorong Zhou, Mahesh S. Padanad, Bret M. Evers, Bethany Smith, Nicole Novaresi, Shruthy Suresh, James A. Richardson, Emily Stein, Jingfei Zhu, Robert E. Hammer and Kathryn A. O'Donnell
Mol Cancer Res February 1 2019 (17) (2) 594-603; DOI: 10.1158/1541-7786.MCR-18-0739
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Advertisement