Advertisement
Cell Cycle and Senescence

Knockdown of PAK4 or PAK1 Inhibits the Proliferation of Mutant KRAS Colon Cancer Cells Independently of RAF/MEK/ERK and PI3K/AKT Signaling

Hana Tabusa, Teresa Brooks and Andrew J. Massey
DOI: 10.1158/1541-7786.MCR-12-0466 Published February 2013

Abstract

The p21-activated kinase (PAK) serine/threonine kinases are important effectors of the small GTPases Rac and Cdc42, and play significant roles in controlling cell growth, motility, and transformation. Knockdown of PAK4 or PAK1 inhibited the proliferation of mutant KRAS or BRAF colon cancer cells in vitro. Dependence on PAK4 or PAK1 protein for colon cancer cell proliferation was independent of PAK4 or PAK1 protein expression levels. Mutant KRAS HCT116 colorectal cells were the most sensitive to PAK4 or PAK1 knockdown resulting in the potent inhibition of anchorage-dependent and -independent proliferation as well as the formation and proliferation of HCT116 colon cancer spheroids. This inhibition of proliferation did not correlate with inhibition of RAF/MEK/ERK or PI3K/AKT signaling. In HCT116 cells, knockdown of PAK4 or PAK1 caused changes to the actin cytoskeleton resulting in reduced basal spread and cell elongation and increased cell rounding. These cytoskeletal rearrangements seemed to be independent of LIMK/cofilin/paxillin phosphorylation. PAK4 or PAK1 knockdown initially induced growth arrest in HCT116 cells followed by cell death at later time points. Inhibition of the antiapoptotic proteins Bcl-2 and Bcl-XL with the pharmacologic inhibitor ABT-737 increased effector caspase activation and apoptosis, and reduced cell survival with PAK4 or PAK1 knockdown. These results support a role for the PAKs in the proliferation of mutant KRAS-driven colorectal carcinoma cells via pathways not involving RAF/MEK/ERK and PI3K/AKT signaling. Mol Cancer Res; 11(2); 109–21. ©2012 AACR.

Introduction

The p21-activated kinases (PAK) are members of the STE20 family of serine/threonine kinases. In mammalian cells, 6 PAK isoforms have been identified and subclassified into 2 families: group I (PAK1-3) and group II (PAK4-6) based on their sequence homology but also on the presence of an inhibitory region present in group I but not group II PAKs (1, 2). The PAKs function as major downstream effectors of the Rho family of small GTPases such as Rac and Cdc42 (3, 4), and therefore play a major role in modulating changes to the actin cytoskeleton organization and dynamics, thereby controlling cell shape and motility in response to extracellular stimuli. PAK1 and PAK4 have been implicated in a number of cellular processes critical for oncogenic transformation including protection from apoptosis and programmed cell death (5, 6), inhibition of cell adhesion (7), and promotion of cell migration (8–10) and anchorage-independent growth (11, 12). Changes to PAK1 mRNA, protein and activity have been reported in variety of human malignancies including bladder (13), breast (14), colorectal (15), and ovarian carcinoma (16). Overexpression of a kinase-activated mutant form of PAK1 induced the anchorage-independent growth of breast cell lines in vitro and breast carcinomas when transgenically expressed in the mouse mammary gland albeit with a long latency (17). PAK1 genomic amplification has been identified as prevalent in luminal breast cancer, whereas strong nuclear and cytoplasmic PAK1 expression was prevalent in squamous non–small cell lung carcinomas (NSCLCs; ref. 14). Selective targeting of PAK1 with short hairpin RNA (shRNA) inhibited breast and NSCLC cell proliferation in vitro and in vivo. Pharmacologic inhibition of X chromosome–linked inhibitor of apoptosis (XIAP) increased effector capsase activation and apoptosis in NSCLC cells following PAK1 knockdown (14).

PAK4 upregulation has been identified in a variety of human cancer cell lines and amplification of the chromosome region containing PAK4 has been frequently observed in pancreatic (18), colorectal (19), and ovarian cancer (20). Overexpression of a kinase-activated mutant form of PAK4 transforms NIH-3T3 cells facilitating anchorage-independent growth and tumor formation in nude mice (7, 11). PAK4 knockdown has an opposing effect on cell transformation. Oncogenic Ras-dependent transformation was severely attenuated in PAK4−/− mouse embryonic fibroblast cells, which were also resistant to tumor formation by an oncogenic variant of the upstream activator Cdc42 (Cdc42V12; refs. 19, 21). Nuclear and cytoplasmic PAK4 and pPAK4 overexpression were observed in ovarian cancer cell lines both in vitro and in vivo. Targeted shRNA-mediated knockdown of PAK4 inhibited the migration, invasion, and proliferation of these ovarian cell lines and their tumorigenesis in nude mice (20).

Mutation of KRAS is a common, early event in the adenoma to carcinoma transition in colorectal cancer. KRAS mutations have been identified in around 40% of human primary cancers (22) and 53% of colorectal cancer cell lines. KRAS mutation, and the resulting activation, activates both mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) signaling pathways. In colorectal carcinoma, overexpression of both PAK1 and PAK4 has been identified in primary human cancers and cancer cell lines (15, 19). PAK1 overexpression was found to correlate with lower survival rates in patients with colorectal cancer (23). PAK1 and PAK4 have been shown to phosphorylate RAF-1 and mitogen-activated protein/extracellular signal–regulated kinase (MEK), and facilitate signaling through the Ras/RAF/MAPK signaling pathways (3, 24, 25) and the dependence on PAK4 versus PAK1 for malignant transformation and cell proliferation may be cell type or context dependent. In mutant KRAS-driven HCT116 cells, overexpression of a kinase dead mutant form of PAK4 severely abrogated the anchorage-independent growth of this cell line (11). A small-molecule inhibitor of PAK4, PF-3758309, potently inhibited the proliferation of a range of human cancer cell lines including multiple colon cancer cell lines and modulated numerous known PAK4-dependent signaling nodes (26). Knockdown of PAK1 in DLD1 cells with a specific shRNA inhibited cell migration, invasion, and proliferation in vitro via extracellular signal–regulated kinase (ERK)- and AKT-dependent pathways (27). Likewise, knockdown of PAK1 in HCT116 colon carcinoma cells inhibited β-catenin expression and transcriptional activity, and inhibited colon cancer growth in vivo (28).

We used the KRAS mutant colon carcinoma cell line HCT116 as a model to investigate and define the role of PAK4 and PAK1 in the proliferation and survival of mutant KRAS colon carcinoma cells and investigate the downstream pathways through which PAK4 and PAK1 exert their oncogenic effects. The interplay between PAK1 and PAK4, and the subsequent reliance on these 2 kinases for cellular growth and survival, was further investigated. Combination studies identified small-molecule antagonists of Bcl-2/Bcl-XL as potentiators of cell death following PAK inhibition. In this study, we show the importance of PAK4 and PAK1 in colon cancer proliferation through pathways that are apparently independent of RAF/MEK/ERK and PI3K/AKT signaling.

Materials and Methods

Cell lines and cell culture

All cell lines were purchased from the American Type Culture Collection and passaged in our laboratory for less than 6 months after resuscitation. HCT116 cells were routinely cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum (FCS) and penicillin/streptomycin at 37°C in a 5% CO2-humidified atmosphere.

Compounds

ABT-737 was purchased from Selleck Chem and dissolved in dimethyl sulfoxide (DMSO) as a 20-mmol/L stock.

Immunoblotting

Anti-PAK1, PAK2, PAK4, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pMEK1 (S298), pMEK1 (S217/221), pERK (T202/Y204), cyclin D, pRAF-1 (S338), pCofilin (S3), pLIMK (T508), pPaxillin (T118), Actin, PARP, pAKT (S473), pGSK3β (S9), and caspase-3 antibodies were purchased from Cell Signaling Technologies.

Cells were washed once with PBS and lysed in radioimmunoprecipitation assay (RIPA) buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentration was determined using BCA Kit (Pierce). Equal amounts of lysate were separated by SDS-PAGE and Western blot analysis conducted using the antibodies indicated earlier.

RNAi and transfection

RNA interference (RNAi) specific to PAK4 (Hs_PAK4_5 UACAUCUCCACCACAUUCUCG, Hs_PAK4_6 UUCCUCUUCCCAAACAUGGTG, Hs_PAK4_11 UUCUUGACGGCCACCAGCUTG and Hs_PAK4_12 UUGUGCAGGUUCUUCAGUCGG) and PAK1 (Hs_PAK1_6 GUAAUUCACAAUGUUUGGGTT, Hs_PAK1_7 UCUCUGGCCGCUCUUUCUCTT, Hs_PAK1_8 UUAGGU GCAGCAAUCAGUGGA and Hs_PAK1_9 UUCAGUUGCAGUUCUCUUCAA) were purchased from Qiagen as were AllStars negative control RNAi and AllStars Hs cell death control RNAi. A total of 1.5 × 105 HCT116 cells per well of a 6-well plate were transfected using Lipofectamine RNAiMAX (Inivtrogen) in OptiMEM (Invitrogen) according to the manufacturer's protocol.

Cell proliferation and survival assays

HCT116 cells were seeded in 96-well plates at a density of 1 × 104 cells per well in DMEM containing 10% FCS for 72 or 96 hours posttransfection. Cell viability was determined using a CellTiter-Glo Luminescent Cell Viability Assay (Promega). For colony formation assays, HCT116 cells were trypsinized 24 hours after transfection and plated in 6-well plates at 200 to 2,000 cells per well. Colonies were allowed to form for 10 days at 37°C in a 5% CO2 humidified atmosphere, fixed, and stained with crystal violet in formaldehyde and counted. Viable colonies were determined as those containing 50 cells or more. For anchorage-independent growth assays, HCT116 cells were trypsinized 24 hours after transfection and plated in 24-well plates at 200 to 2,000 cells per well in 0.4% low melting point agarose on a layer of 0.6% agarose in media containing 10% FCS. The agarose layers were subsequently overlayed with 1 mL of DMEM containing 10% FCS and incubated at 37°C in a 5% CO2-humidified atmosphere for 14 days. Colonies were stained using MTT reagent (Sigma) and counted.

Spheroid growth assays

Multicellular tumor spheroid assays were conducted essentially as described previously (29). A total of 1 × 103 HCT116 cells per well in DMEM containing 10% FCS were seeded in 96-well round-bottomed ultra-low attachment microplates (Corning Costar), centrifuged at 1,000 × g for 3 minutes and allowed to form into spheroids at 37°C in a 5% CO2 incubator for 72 hours. Spheroid cell viability was determined using a CellTiter-Glo Luminescent Cell Viability Assay (Promega) and imaged using a Zeiss Axiovert 200 microscope and ×10 or ×20 objective. Colonospheres were cultured essentially as described earlier (30). HCT116 cells were cultured in DMEM containing B27 supplement (Invitrogen) plus EGF and fibroblast growth factor (FGF; Invitrogen).

Immunofluorescence microscopy

A total of 1 × 104 HCT116 cells/chamber were seeded in 8-chamber glass slides. Following fixation with formaldehyde and permeabilization, F-actin was selectively labeled with an Alexa Fluor 488–labeled phalloidin (Invitrogen). Cells were subsequently imaged using a Zeiss Axiovert 200 microscope and ×40 objective.

7-Aminoactinomycin D (7-AAD) cell viability assay

RNAi-transfected cells were harvested by trypsinization, washed once with PBS, and stained with 7-AAD for 10 minutes at room temperature in the dark. Viable (7-AAD-negative) and dead (7-AAD-positive) cell populations were quantitated by flow cytometry using a FACSArray flow cytometer.

Flow cytometry

RNAi-transfected HCT116 cells were harvested by trypsinization, washed, and fixed in ice-cold 70% ethanol before being stained with propidium iodide (PI) containing RNase A. Cell-cycle profiles were collected on a FACSArray flow cytometer and analyzed with FACSDiva software (Becton Dickinson).

Growth in 3-dimensional culture conditions

HCT116, HT29, and DLD1 cells were grown in DMEM containing 10% FCS in 12-well Alvetex plates (Reinnervate) or 6-well AlgiMatrix plates (Invitrogen) according to the manufacturer's recommended protocol.

Statistical analysis

Results were analyzed using a Student t test tool within the data analysis package provided by Microsoft Excel.

Results

PAK4 is required for the proliferation of colon carcinoma cells in vitro in anchorage-dependant culture

The role of PAK4 and PAK1 in the proliferation of colon carcinoma cells in vitro was evaluated in a panel of KRAS mutant (HCT116, SW620, DLD1, and SW480) or BRAF mutant (HT29, Colo205, and RKO) colon carcinoma cell lines. Knockdown of PAK4 resulted in a 43% to 89% reduction (P < 0.001) in cell proliferation in 6 of 7 cell lines (Fig. 1A). Conversely, knockdown of PAK1 reduced cell proliferation by 45% to 50% (P < 0.001) in 2 of 7 cell lines. Simultaneous knockdown of PAK4 and PAK1 did not decrease the cell proliferation beyond that seen with knockdown of PAK4 alone in all 7 colon cancer cell lines (data not shown). Mutant KRAS HCT116 cells exhibited the greatest sensitivity to either PAK4 or PAK1 knockdown, and so the effect of PAK4 or PAK1 knockdown using specific RNAi oligonucleotides on the proliferation of this cell line was investigated in more detail under anchorage-dependant growth conditions. Knockdown of PAK4 inhibited the proliferation of HCT116 cells up to 95% (P < 0.001), whereas knockdown of PAK1 inhibited proliferation up to 80% (P < 0.001) after 96 hours transfection (Fig. 1B). Transient knockdown of PAK4 but not PAK1 for 72 hours produced a small but significant (P < 0.05 compared with nontargeting RNAi) reduction in cell proliferation (Fig. 1C). Increasing the transient knockdown to 96 hours significantly increased the inhibition of cell proliferation by both PAK4- and PAK1-targeting RNAi (P < 0.001). RNAi-mediated knockdown of PAK4 with Hs_PAK4_6 reduced cell proliferation by 46% at 72 hours to 97% after 96 hours and PAK1 knockdown with Hs_PAK1_7 by 14% at 72 hours to 85% at 96 hours.

Figure 1.
Figure 1.

Knockdown of PAK4 reduces the proliferation of mutant KRAS or BRAF colon carcinoma cells in vitro. A, proliferation of a panel of colon cancer cell lines following transfection with specific RNAi oligonucleotides to PAK4 (PAK4_6) or PAK1 (PAK1_7) was determined using CellTiter-Glo 96 hours after transfection. Values are normalized against the scrambled RNAi-negative control. **, P < 0.01. B, proliferation of HCT116 colon carcinoma cells transfected with specific RNAi oligonucleotides to PAK4 or PAK1 was determined by CellTiter-Glo 96 hours after transfection. C, the time dependence of PAK inhibition on HCT116 cell proliferation (as measured using CellTiter-Glo) was determined 72 or 96 hours after transfection. D, proliferation and survival of HCT116 cells following knockdown of PAK4 or PAK1 was measured using colony formation 10 days after transfection. E, the number of viable HCT116 cells following PAK4 or PAK1 knockdown was determined by 7-AAD staining of unfixed cells 72 or 96 hours after transfection. F, proliferation and survival of HCT116 cells following combinatorial knockdown of PAK4 or PAK1 was measured using CellTiter-Glo 96 hours after transfection. The values are the mean of at least 6 determinations ± SD. G, cell-cycle changes associated with knockdown of PAK4 or PAK1. HCT116 cells were transfected with specific olignucloetides to PAK4 or PAK1 for 72 hours. The cell-cycle profile was determined by PI staining and flow cytometry. −ve, AllStars negative control RNAi; +ve, AllStars Hs cell death control RNAi. ***, P < 0.001.

Assessment of the ability of PAK4 or PAK1 RNAi to inhibit the colony forming ability of HCT116 cells was also assessed. Knockdown of PAK4 reduced HCT116 colony forming ability by 97%, whereas PAK1 knockdown reduced it by 74% (P < 0.001, Fig. 1D). The reduction of PAK4 or PAK1 protein resulted in the initial inhibition of cell proliferation as evidenced by the small increase in 7-AAD-positive cells after 72-hour incubation with specific RNAi (Fig. 1E). Increasing the incubation time from 72 to 96 hours resulted in increased cell death. For example, with the PAK4-specific RNAi PAK4_6, the fraction of 7-AAD-positive cells increased from 23.5% at 72 hours to 52.6% at 96 hours. Simultaneous knockdown of PAK4 and PAK1 did not dramatically decrease the proliferation of HCT116 cells beyond that induced by PAK4 knockdown alone (Fig. 1C, D, and F). To determine the effect of PAK4 or PAK1 protein depletion on the cell cycle, the cell-cycle profile of HCT116 cells was determined 72 or 96 hours after transfection with specific RNAi. Knockdown of PAK4 or PAK1 reduced the fraction of cells in G1 and increased the fraction of cells with sub-G1 DNA content (Fig. 1G and Supplementary Fig. S1). The effect of PAK protein knockdown on the fraction of sub-G1 cells was time dependent. The percentage of sub-G1 cells increased following a 96-hour incubation with specific RNAi as compared with 72-hour incubation. Despite knocking PAK4 or PAK1 protein levels down to a similar extent as the other 3 targeted RNAis, 1 RNAi targeting PAK4 (PAK4_5) and 1 targeting PAK1 (PAK1_6) exhibited a reduced effect on HCT116 cell proliferation in the Cell Titer Glo assay compared with the other RNAis (Fig. 1B and C). Hs_PAK4_5 RNAi, however, was able to reduce the colony forming ability of HCT116 cells by 84% (Fig. 1D). The reason for the reduced activity of these 2 RNAis was not apparent and was not investigated further.

Expression levels of PAK1 or PAK4 do not correlate with growth inhibition sensitivity to knockdown

PAK1 and PAK4 amplification has been identified in a range of human cancer types namely breast, colon, ovarian, and NSCLC for PAK1 and pancreatic, colon, and ovarian cancer for PAK4. The protein expression levels of PAK1, 2 or PAK4 in whole-cell lysates from a range of solid human cancer cell lines was assessed by immunoblotting (Fig. 2). The expression levels of the 3 PAK isoforms varied across the panel of 14 solid cancer cell lines studied. In the 5 colon cancer cell lines in the panel (Colo205, DLD1, HCT116, HT29, and SW620), no consistent expression profile was evident. All of the colon cancer cell lines had detectable levels of PAK1 and PAK4 though the levels of PAK4 were low in the Colo205 and DLD1 cell lines. With the exception of the A549 and MDA-MB-453 tumor lysates, the expression levels of PAK2 seemed relatively consistent across the panel of cell lines. MDA-MB-453 had noticeably higher expression levels of PAK2 but had virtually no detectable levels of PAK1 or PAK4. No correlation between inhibition of proliferation by PAK4- or PAK1-specific RNAi and expression levels of PAK4 or PAK1 protein was evident.

Figure 2.
Figure 2.

Expression levels of PAK1 or PAK4 do not correlate with growth inhibition sensitivity to knockdown. Protein expression levels of various PAK isoforms in human cancer cell lines were determined by immunoblot analysis. Colon carcinoma cell lines are indicated with an arrow.

Inhibition of proliferation of HCT116 colon carcinoma cells by PAK4 or PAK1 RNAi is independent of RAF/MEK/ERK signaling

Previous studies have shown an association between the PAKs and the RAF/MEK/ERK and PI3K/AKT signaling pathways. To assess the mechanism by which PAK4 or PAK1 contribute to HCT116 colon carcinoma cell proliferation, we examined the effect of transient RNAi-mediated knockdown of PAK4 or PAK1 on RAF/MEK/ERK and PI3K/AKT signaling. The 4 RNAi-targeting PAK4 efficiently reduced PAK4 protein levels with minimal effect on PAK1 protein levels. Likewise, the 4 RNAi-targeting PAK1 efficiently reduced PAK1 protein levels with minimal effect on PAK4 protein levels (Fig. 3A and Supplementary Fig. S2). The effects of PAK1 or PAK4 knockdown on RAF, MEK, ERK, and AKT phosphorylation were not consistent across the 4 RNAi oligonulceotides used and did not result in consistent changes to cyclin D levels. Reduction in PAK4 protein levels resulted in a reduction in cyclin D protein levels with 1 RNAi, an increase with another RNAi and no change with 2 additional RNAis (Fig. 3A). Following knockdown of PAK1, cyclin D levels were reduced with 3 oligonucleotides and induced by a fourth. These changes in cyclin D protein levels did not correlate with suppression of cell proliferation. In HCT116 cells, the cellular phenotype associated with knockdown of PAK4 seemed to predominate over PAK1 (Fig. 3B). Suppression of PAK4 protein expression following transfection of HCT116 cells with the specific RNAi PAK4_6 was observed to at least 120 hours posttransfection. Likewise, transfection of HCT116 cells with the PAK1-specific RNAi PAK1_7 suppressed PAK1 protein expression for at least 120 hours posttransfection (Fig. 3C). In summary, the effect of PAK4 and PAK1 on HCT116 cell proliferation seems to not be mediated via the RAF-1/MEK dependent control of cyclin D protein levels. PAK4 and PAK1 seem to drive cell proliferation via additional, as yet unidentified, mechanisms that are independent of the RAF/MEK/ERK and PI3K/AKT signaling pathways.

Figure 3.
Figure 3.

Inhibition of proliferation of HCT116 colon carcinoma cells by PAK4 or PAK1 RNAi is independent of RAF/MEK/ERK signaling. HCT116 cells were transfected with specific RNAi oligonucleotides to PAK4 or PAK1 (A), or combinations of PAK4 plus PAK1 (B), and changes to signaling pathways determined by immunoblot analysis 48 hours after transfection. C, the duration of PAK4 or PAK1 knockdown was evaluated in HCT116 cells transfected with the specific RNAi oligonucleotides PAK4_6 or PAK1_7 for up to 5 days.

PAK4 or PAK1 knockdown modulates actin cytoskeletal rearrangements but not via the LIMK and paxillin signaling pathways.

The PAKs have been associated with the regulation of the actin cytoskeleton in normal and cancer cells (21). PAKs are the major effectors of the small Rho GTPases Rac1 and Cdc42, which play critical roles in cell morphology, and subsequent cell migration, proliferation, and invasion. Knockdown of either PAK4 or PAK1 with specific RNAi oligonucleotides induced a reduction in the basal spread area of cells and a concomitant increase in cell rounding (Fig. 4A). Furthermore, PAK4 or PAK1 reduced the amount of HCT116 cell elongation compared with those treated with a control RNAi. The LIMK/cofilin/paxillin pathway plays a key role in controlling actin dynamics and subsequent cytoskeletal rearrangements. Modulation of actin dynamics through PAK4-dependent cofilin phosphorylation has been shown to affect cell migration and polarization and thereby cell proliferation in a variety of human cancer cell types (8, 20). In HCT116 cells, the observed F-actin rearrangements (as determined by phalloidin staining) induced by knockdown of PAK4 or PAK1 did not correlate with decreased cofilin phosphorylation on serine 9 or paxillin on tyrosine 118 (Fig. 4B). Combinatorial knockdown of PAK4 and PAK1 resulted in the same changes to cofilin and paxillin phosphorylation as the single gene knockdowns (Fig. 4C). In HCT116 colon carcinoma cells, control of the actin cytoskeleton by PAK4 and PAK1 does not seem to proceed via the LIM kinase (LIMK) and paxillin signaling pathways.

Figure 4.
Figure 4.

PAK4 or PAK1 knockdown alters actin cytoskeletal arrangements in HCT116 colon cancer cells. A, HCT116 cells were transfected with specific RNAi oligonucleotides to PAK4 (PAK4_6) or PAK1 (PAK1_7) for 48 hours. Fixed cells were stained with fluorescent phalloidin to detect F-actin and imaged using a ×40 objective. Enlarged sections of the image (as defined by the white box) are shown later. Changes to the phosphorylation levels of components of the LIMK signaling pathway were determined by immunoblotting 48 hours after transfection with oligonucleotides specific to PAK4 or PAK1 (B) or in combination (C).

PAK4 and PAK1 are essential for HCT116 colon cancer cell proliferation in anchorage-independent culture

The PAKs have been shown to have a clear role in cytoskeletal remodeling, cell motility and invasion, and the promotion of anchorage-independent growth. Given the increased cell–cell interactions in 3-dimensional culture (anchorage-independent culture), we postulated that cancer cells may be more PAK dependent under these growth conditions. To examine the role of PAK4 and PAK1 on anchorage-independent survival, mutant KRAS HCT116 cells were transiently transfected with RNAi oligonucleotides specific to either PAK4 or PAK1 before being plated in low melting point agarose. Knockdown of PAK4 or PAK1 inhibited the anchorage-independent proliferation and survival of HCT116 colon cancer cells growing in low melting point agarose (Fig. 5A). PAK4 knockdown reduced HCT116 cell survival by 88.3%, whereas knockdown of PAK1 was less effective reducing cell survival by 65.4% (P < 0.001%) compared with the negative control, scrambled RNAi. Dual knockdown of PAK4 plus PAK1 did not dramatically reduce cell survival compared with PAK4 knockdown alone.

Figure 5.
Figure 5.

PAK4 and PAK1 are essential for HCT116 colon cancer cell proliferation in anchorage-independent culture. A, HCT116 cells were transfected with RNAi oligonucleotides specific to PAK4 (PAK4_6) or PAK1 (PAK1_7) for 24 hours before being replated in low melting point agarose. Colonies were allowed to form for 14 days before being stained with MTT and counted. Values are the mean of 3 determinations ± SD. ***, P < 0.001 compared with −ve control RNAi. B, HCT116 colon cancer cells were transfected with specific RNAi oligonucleotides to PAK4 or PAK1 for 24 hours before being transferred to round-bottomed, low-adherence 96-well plates containing 1% or 10% FCS. Spheroids were allowed to form for a further 72 hours before being imaged under a Zeiss Axiovert microscope. C, cell viability was determined using CellTiter-Glo and normalized to the untreated (UT) control 72 hours after transfection. The values are the mean of 8 determinations ± SD. ***, P < 0.001. Scale bar, 100 μm.

Multicellular tumor spheroids more closely resemble the avascular regions of human tumors with respect to their morphologic and histopathologic features than the same cell line grown anchorage dependently. Tumor cells from such spheroids assemble an appropriate extracellular matrix along with complex cell–cell and cell–matrix interactions as well as oxygen and pH gradients in larger spheroids (29). Knockdown of PAK4 or PAK1 did not inhibit the formation of HCT116 colon cancer spheroids. However, spheroids formed from HCT116 cells lacking either PAK4 or PAK1, and especially those lacking both PAK4 and PAK1, appeared less compacted and the extracellular matrix supporting the spheroid less well organized (Fig. 5B). Knockdown of PAK4 reduced spheroid cell growth, as evidenced by the reduction in total ATP content of the spheroid, by 79% and PAK1 by 52% (Fig. 5C; P < 0.001 compared with control RNAi). The effect on spheroid cell proliferation following PAK knockdown seemed independent of FCS concentration.

We evaluated further the effect of growing colon cancer cells in a variety of 3-dimensional culture systems on signaling pathways postulated to be PAK dependent. A comparison of MEK/ERK and cofilin signaling was made between (i) normal anchorage-dependent growth on cell culture plastic plates; (ii) anchorage-independent growth as multicellular colon tumor spheroids [MCTS in media postulated to increase the stem cell such as properties of the cells (colonospheres)], on a highly porous polystyrene scaffold (Alvetex); and (iii) embedded in a porous alginate gel (AlgiMatrix). Anchorage-independent growth-modulated MEK/ERK and LIMK signaling compared with anchorage-dependent growth that was cell line and culture system dependent (Fig. 6). For HCT116 cells, growth as spheroids, colonospheres, or in AlgiMatrix resulted in a reduction in MEK1 S298 phosphorylation, but only under the AlgiMatrix and spheroid growth conditions did this result in a decrease in cyclin D levels (Fig. 6). Conversely, growth in AlgiMatrix but none of the other anchorage-independent systems dramatically induced phospho-cofilin in HCT116 cells. Growth on the Alvetex scaffold reduced protein expression levels of both PAK4 and PAK1 in HCT116 and DLD1 cells. This reduction in PAK protein levels, however, had little effect on MEK1 S298 and ERK T202/Y204 phosphorylation and cyclin D levels. Despite differences in MEK and cofilin phosphorylation, and cyclin D levels, HCT116 cells remained sensitive under 3-dimensional culture conditions to growth inhibition following PAK4 or PAK1 knockdown. This provides additional evidence to suggest that PAK4 and PAK1 drive colon cancer cell proliferation through additional pathways independently of RAF/MEK/ERK.

Figure 6.
Figure 6.

Growth in 3-dimensional culture conditions modulates PAK signaling pathways in colon cancer cell lines. HCT116, HT29, or DLD1 colon cancer cells were grown in 2-dimensional culture attached to cell culture plastic plates or in a variety of 3-dimensional culture systems—multicellular colon tumor spheroids, colon cancer stem cell-like spheroids (colonospheres), attached to Alvetex scaffold, or embedded in AlgiMatrix. Protein expression changes from whole-cell extracts were determined by immunoblot analysis.

Bcl-2/Bcl-XL inhibition potentiates cell killing following PAK inhibition

ABT-737 is a small-molecular antagonist of the prosurvival Bcl-2, Bcl-XL, and Bcl-w but not Mcl-1 proteins. It mimics the proapoptotic BH3 proteins through binding to the proapoptotic Bcl-2 homology domain (BH3) groove on the Bcl-2 family proteins thereby inhibiting their prosurvival activity. As a single agent, ABT-737 induces apoptosis in a limited number of tumor types (31, 32). However, ABT-737 (and the closely related analog ABT-263) has been shown to enhance the apoptotic potential of a range of novel-targeted therapeutics and cytotoxic chemotherapeutics.

Knockdown of PAK4 or PAK1 with RNAi induced a small increase in apoptotic HCT116 cells as measured by an increase in cleaved caspase-3 and -7 (Fig. 7A and C), cleaved PARP (Fig. 7C), and PI staining tumor spheroid cells (Fig. 7E) compared with cells transfected with scrambled RNAi. Addition of ABT-737 to HCT116 cells transfected with PAK4 or PAK1 RNAi increased (P < 0.001) the levels of activated caspase-3 and -7 (Fig. 7A). This increased activation of caspase-dependent apoptosis by ABT-737 resulted in a decrease in HCT116 survival. Following the knockdown of PAK4, HCT116 cell survival was reduced from 54% to 20% (P < 0.001) in the presence of ABT-737 (Fig. 7B). Likewise, ABT-737 in combination with the knockdown of PAK1 resulted in a reduction in HCT116 cell survival from 90% to 42% (P < 0.001). The decreased cell viability induced by the combination of either PAK4 or PAK1 RNAi with ABT-737 resulted in an induction of apoptosis as measured by an increase in PARP and caspase-3 cleavage by immunoblotting (Fig. 7C).

Figure 7.
Figure 7.

Inhibition of Bcl-2/Bcl-XL increases the antitumor activity of PAK inhibition in anchorage-dependent in vitro culture and human colon cancer spheroids. A, HCT116 cells were transfected with RNAi oligonucleotides specific to PAK4 (PAK4_6) or PAK1 (PAK1_7) for 48 hours in the presence or absence of 5 μmol/L ABT-737. Caspase-3/7 activation was measured using a homogenous caspase activation kit. The values were normalized to the untreated control and are the mean of 3 determinations ± SD. ***, P < 0.001. B, HCT116 cells transfected with RNAi oligonucleotides specific to PAK4 or PAK1 were treated with 0 or 5 μmol/L ABT-737 for 72 hours. Cell viability was determined using CellTiter-Glo. Values were normalized to the untreated control and are the mean of 4 determinations ± SD. *, P < 0.05; **, P < 0.01. C, protein extracts from HCT116 cells transfected with RNAi oligonucleotides treated ± 5 μmol/L ABT-737 for 48 hours were analyzed for changes to apoptosis proteins by immunoblotting. For PARP, both full-length 116 kDa (FL) and the 89 kDa cleavage product (CL) were detected. D, HCT116 colon cancer cells were transfected with specific RNAi oligonucleotides to PAK4 or PAK1 for 24 hours before being transferred to round-bottomed, low-adherence 96-well plates containing 10% FCS. Spheroids were allowed to form for a further 72 hours in the presence of 0 or 5 μmol/L ABT-737. Cell viability was determined using CellTiter-Glo and normalized to the untreated (UT) control. The values are the mean of 8 determinations ± SD. ***, P < 0.001. E, spheroids formed as in (D) earlier were labeled with PI for 30 minutes and imaged using phase contrast and fluorescence on a Zeiss Axiovert microscope. Scale bar, 100 μm.

In multicellular tumor spheroids deficient in either PAK4 or PAK1, treatment with ABT-737 resulted in a small but significant decrease (P < 0.001) in the fraction of viable cells within the tumor spheroid (Fig. 7D). ABT-737 treatment reduced the fraction of viable cells from 26% to 17% following PAK4 knockdown and from 75% to 40% following PAK1 knockdown. Cell death following combinatorial knockdown of PAK4 with PAK1 was not increased beyond that of the single gene knockdowns. This increased cell death following ABT-737 of PAK4 or PAK1 RNAi-treated spheroids was confirmed by PI staining of the treated spheroids. The fraction of the cells staining positive for PI within PAK4 or PAK1 RNAi knockdown spheroids was increased following treatment with ABT-737 (Fig. 7E).

Discussion

The PAK family of kinases have been shown to modulate cell signaling pathways critical for cancer cell proliferation, transformation, migration, and invasion (3, 25), and therefore suggest themselves as potentially important targets for therapeutic intervention. In this study, we evaluated the role of PAK4 and PAK1 in the proliferation and survival of a range of colon carcinoma cell lines harboring mutations in either KRAS or BRAF. Knockdown of PAK4 inhibited the proliferation of 3 of 4 of the KRAS-mutant and 3 of 3 of the BRAF-mutant colon cancer cell lines. Combinatorial knockdown of PAK4 and PAK1 was not significantly more antiproliferative than knockdown of either PAK4 or PAK1 alone. The mutant KRAS HCT116 cell line showed the greatest sensitivity to PAK4 or PAK1 knockdown. Knockdown of PAK4 or PAK1 inhibited the anchorage-dependent growth on plastic and the anchorage-independent growth in low melting point agarose of HCT116 colon cancer cells as well as the growth and formation of multicellular colon cancer spheroids. Under all growth conditions studied, knockdown of PAK4 had a greater inhibitory effect on cell proliferation than knockdown of PAK1. Inhibition of proliferation occurred at an earlier time point following PAK4 RNAi treatment compared with PAK1 RNAi despite similar kinetics of protein downregulation. As was seen with the other cell lines, combinatorial knockdown of PAK4 and PAK1 was not significantly more antiproliferative than knockdown of either PAK4 or PAK1 alone under any of the different growth conditions tested. Despite reducing protein levels of PAK4 or PAK1 to a similar extent as the other RNAi, PAK4_5 and PAK1_6 did not inhibit cellular proliferation to the same extent. The reasons for this are unclear but potential explanations include differences in either the kinetics or duration of mRNA and subsequent protein reduction, or knockdown of an off target protein that renders the cells insensitive to PAK knockdown.

These observations are in keeping with previous studies showing a crucial role for PAK4 or PAK1 in cancer cell proliferation and survival. Knockdown of PAK4 reduced the proliferation and survival of ovarian cancer cells (20), pancreatic cancer 8988T cells (18), JEG3, and JAR choriocarcinoma cells (33) and increased the levels of apoptotic proteins in gastric cancer cell lines (34). In comparison, knockdown of PAK1 inhibited the anchorage-dependent (14) and -independent (35) growth of breast cancer cells, the proliferation of NSCLC cancers in vitro and in vivo (14), colon cancer in vitro (27) and in vivo (28), and the growth of gastric cancer cells anchorage-dependently and -independently as well as tumor xenografts (36). In previous studies, gene amplification or increased protein expression of PAK4 or PAK1 has been suggested to correlate with dependence on this pathway for tumor progression and tumor cell proliferation. In this study, the dependence of colon cancer cells on PAK4 or PAK1 for proliferation did not correlate with increased expression of either PAK4 or PAK1 protein. Compensation for PAK1 loss by PAK2 did not seem to be responsible for the variable effect of PAK1 RNAi on cell proliferation in the colon cancer cell lines studied. A recent study by Baskaran and colleagues (37) suggests that PAK4 (unlike PAK1) is constitutively phosphorylated on serine 474 and held inactive by an N-terminal auto-inhibitory domain. Binding of Cdc42 relieves this auto-inhibition resulting in the full activation of PAK4. Reliance on gene amplification or protein overexpression to select patient populations that might be sensitive to PAK-directed small-molecule therapeutics could result in potentially sensitive patient populations being overlooked. Further work is needed to identify additional cellular biomarkers of PAK activation status to aid this patient selection.

Downregulation of PAK4, PAK1, or PAK4 plus PAK1 in HCT116 colon cancer cells induced a predominantly cytostatic effect on cell proliferation that converted to cell death on prolonged protein knockdown. Inhibition of Bcl-2/Bcl-XL with ABT-737 increased caspase-dependent apoptosis and cell death in HCT116 cells following RNAi knockdown of PAK4 or PAK1. Previous studies in NSCLC cells have shown that antagonism of the antiapoptotic inhibitor of apoptosis (IAP) proteins with a pharmacologic inhibitor in combination with PAK1 ablation increased the number of cells undergoing apoptosis (14). This differed substantially from the antiproliferative effect observed after single-agent inhibition of PAK1 in these cells. PAK4 and PAK1 have both been shown to protect against apoptotic cell death by direct phosphorylation of Bad on serine 136 (6, 38). Targeting PAK4 or PAK1 may be a mechanism to prime tumor populations resistant to small-molecule inhibitors of antiapoptosis proteins, such as Bcl-2, Bcl-XL, or XIAP to apoptosis induction by these small molecules. Inhibitors of both Bcl-2/Bcl-XL and XIAP are currently in early-stage clinical trials and the combination of PAK inhibitors with inhibitors of apoptosis may be a useful therapeutic regimen for a variety of human cancers.

To further understand the mechanism by which PAK4 and PAK1 regulate cell proliferation in mutant KRAS HCT116 colon cancer cells, we examined the effect of PAK4 and PAK1 knockdown on pathways previously shown to be modulated by the PAKs. PAK4 and PAK1 have been found to phosphorylate common substrates in cells and modulate the same signaling pathways namely the RAF/MEK, LIMK/Cofilin, HGF/MET, Rho GTPase exchange factors, PI3K/AKT, and apoptotic regulatory (BAD) pathways (2–4, 24, 25, 39). In the case of the RAF/MEK pathway, PAK4 and PAK1 have both been shown to phosphorylate MEK on serine 298 (40, 41) and RAF on serine 338 (42, 43). In HCT116 colon cancer cells, inhibition of cell proliferation induced by knockdown of PAK4 or PAK1 did not correlate with consistent reduction in phosphorylation of RAF-1, MEK, or ERK and subsequent decrease in cyclin D protein levels. The relationship between PAK4 and MEK/cyclin D activation was independent of cell culture conditions. In anchorage-independent culture, the phosphorylation of MEK1 on serine 298 and the protein levels of cyclin D were reduced compared with cells growing attached to plastic. However, HCT116 cells growing under these conditions were still sensitive to growth inhibition induced by PAK4 knockdown. Likewise, PAK4 and PAK1 have been shown to modulate cell migration and invasion (9) through modulation of actin dynamics via downstream targets of LIMK (8, 44, 45). Knockdown of PAK4 and PAK1 dramatically altered the actin cytoskeleton in HCT116 cells resulting in increased cell rounding and reduced basal spread and cell elongation but did not modulate downstream targets of the LIMK pathway. In colon cancer cells, PAK4 and PAK1 promote tumor cell proliferation independently of the RAF/MEK/ERK pathway and actin cytoskeleton arrangements independently of LIMK. The necessity of the interaction with Cdc42 for PAK4 activity and its involvement in cell adhesion dynamics suggests that PAK4 has the potential to control cancer cell proliferation via modulation of cell–cell interactions.

Despite the ability of PAK4 and PAK1 to phosphorylate identical protein substrates albeit often in different cancer cell lines, and are activated by the same small G-proteins, PAK4 and PAK1 do not show functional redundancy. In all the colon cell lines studied, including HCT116s, PAK1 did not compensate for the loss of PAK4 and vice versa. It is also unclear as to whether PAK5 and PAK6 can functionally substitute for PAK4. This was further reinforced by the observation that PAK1 RNAi does not increase the antiproliferative activity of PAK4 RNAi and vice versa. Knockdown of PAK4 or PAK1 did not result in consistent changes to MEK1, RAF-1, paxillin, or cofilin phosphorylation in HCT116 cells and, following knockdown of PAK4 and PAK1, the cellular phenotype associated with knockdown of PAK4 seemed to predominate over PAK1.

Overall our studies suggest that PAK4 and PAK1 are crucial for the anchorage-dependent and -independent proliferation but not the survival of colon cancer cells in vitro via pathways independent of RAF/MEK/ERK and that protein overexpression was not a determinant of PAK signaling dependence. Further work is needed to identify biomarkers of the activation status of PAK1 and PAK4 in human cancer cells, and further elucidate the mechanisms by which group I and group II PAK substrate specificity is determined in a cancer cell context, and the signaling pathways modulated by the PAKs.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Authors' Contributions

Conception and design: A.J. Massey

Development of methodology: T. Brooks, A.J. Massey

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): H. Tabusa, A.J. Massey

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): A.J. Massey

Writing, review, and/or revision of the manuscript: A.J. Massey

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): T. Brooks

Study supervision: A.J. Massey

Acknowledgments

The authors thank Mike Wood for critically reading and commenting on the article.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

  • Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/).

  • Received August 1, 2012.
  • Revision received October 26, 2012.
  • Accepted November 20, 2012.

References

  1. 1.↵
    1. Arias-Romero LE,
    2. Chernoff J
    . A tale of two Paks. Biol Cell 2008;100:97–108.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Eswaran J,
    2. Soundararajan M,
    3. Kumar R,
    4. Knapp S
    . UnPAKing the class differences among p21-activated kinases. Trends Biochem Sci 2008;33:394–403.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Wells CM,
    2. Jones GE
    . The emerging importance of group II PAKs. Biochem J 2010;425:465–73.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. Eswaran J,
    2. Soundararajan M,
    3. Knapp S
    . Targeting group II PAKs in cancer and metastasis. Cancer Metastasis Rev 2009;28:209–17.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Li X,
    2. Minden A
    . PAK4 functions in tumor necrosis factor (TNF) alpha-induced survival pathways by facilitating TRADD binding to the TNF receptor. J Biol Chem 2005;280:41192–200.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    1. Schürmann A,
    2. Mooney AF,
    3. Sanders LC,
    4. Sells MA,
    5. Wang HG,
    6. Reed JC,
    7. et al.
    p21-activated kinase 1 phosphorylates the death agonist bad and protects cells from apoptosis. Mol Cell Biol 2000;20:453–61.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Qu J,
    2. Cammarano MS,
    3. Shi Q,
    4. Ha KC,
    5. De Lanerolle P,
    6. Minden A
    . Activated PAK4 regulates cell adhesion and anchorage-independent growth. Mol Cell Biol 2001;21:3523–33.
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    1. Ahmed T,
    2. Shea K,
    3. Masters JR,
    4. Jones GE,
    5. Wells CM
    . A PAK4-LIMK1 pathway drives prostate cancer cell migration downstream of HGF. Cell Signal 2008;20:1320–8.
    OpenUrlCrossRefPubMed
  9. 9.↵
    1. Whale A,
    2. Hashim FN,
    3. Fram S,
    4. Jones GE,
    5. Wells CM
    . Signalling to cancer cell invasion through PAK family kinases. Front Biosci 2011;16:849–64.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Coniglio SJ,
    2. Zavarella S,
    3. Symons MH
    . Pak1 and Pak2 mediate tumor cell invasion through distinct signaling mechanisms. Mol Cell Biol 2008;28:4162–72.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    1. Callow MG,
    2. Clairvoyant F,
    3. Zhu S,
    4. Schryver B,
    5. Whyte DB,
    6. Bischoff JR,
    7. et al.
    Requirement for PAK4 in the anchorage-independent growth of human cancer cell lines. J Biol Chem 2002;277:550–8.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Vadlamudi RK,
    2. Adam L,
    3. Wang RA,
    4. Mandal M,
    5. Nguyen D,
    6. Sahin A,
    7. et al.
    Regulatable expression of p21-activated kinase-1 promotes anchorage-independent growth and abnormal organization of mitotic spindles in human epithelial breast cancer cells. J Biol Chem 2000;275:36238–44.
    OpenUrlAbstract/FREE Full Text
  13. 13.↵
    1. Ito M,
    2. Nishiyama H,
    3. Kawanishi H,
    4. Matsui S,
    5. Guilford P,
    6. Reeve A,
    7. et al.
    P21-activated kinase 1: a new molecular marker for intravesical recurrence after transurethral resection of bladder cancer. J Urol 2007;178:1073–9.
    OpenUrlCrossRefPubMed
  14. 14.↵
    1. Ong CC,
    2. Jubb AM,
    3. Haverty PM,
    4. Zhou W,
    5. Tran V,
    6. Truong T,
    7. et al.
    Targeting p21-activated kinase 1 (PAK1) to induce apoptosis of tumor cells. Proc Natl Acad Sci U S A 2011;108:7177–82.
    OpenUrlAbstract/FREE Full Text
  15. 15.↵
    1. Carter JH,
    2. Douglass LE,
    3. Deddens JA,
    4. Colligan BM,
    5. Bhatt TR,
    6. Pemberton JO,
    7. et al.
    Pak-1 expression increases with progression of colorectal carcinomas to metastasis. Clin Cancer Res 2004;10:3448–56.
    OpenUrlAbstract/FREE Full Text
  16. 16.↵
    1. Brown LA,
    2. Kalloger SE,
    3. Miller MA,
    4. Shih IeM,
    5. McKinney SE,
    6. Santos JL,
    7. et al.
    Amplification of 11q13 in ovarian carcinoma. Genes Chromosomes Cancer 2008;47:481–9.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Wang RA,
    2. Zhang H,
    3. Balasenthil S,
    4. Medina D,
    5. Kumar R
    . PAK1 hyperactivation is sufficient for mammary gland tumor formation. Oncogene 2006;25:2931–6.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Kimmelman AC,
    2. Hezel AF,
    3. Aguirre AJ,
    4. Zheng H,
    5. Paik JH,
    6. Ying H,
    7. et al.
    Genomic alterations link Rho family of GTPases to the highly invasive phenotype of pancreas cancer. Proc Natl Acad Sci U S A 2008;105:19372–7.
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    1. Liu Y,
    2. Xiao H,
    3. Tian Y,
    4. Nekrasova T,
    5. Hao X,
    6. Lee HJ,
    7. et al.
    The pak4 protein kinase plays a key role in cell survival and tumorigenesis in athymic mice. Mol Cancer Res 2008;6:1215–24.
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    1. Siu MK,
    2. Chan HY,
    3. Kong DS,
    4. Wong ES,
    5. Wong OG,
    6. Ngan HY,
    7. et al.
    p21-activated kinase 4 regulates ovarian cancer cell proliferation, migration, and invasion and contributes to poor prognosis in patients. Proc Natl Acad Sci U S A 2010;107:18622–7.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    1. Abo A,
    2. Qu J,
    3. Cammarano MS,
    4. Dan C,
    5. Fritsch A,
    6. Baud V,
    7. et al.
    PAK4, a novel effector for Cdc42Hs, is implicated in the reorganization of the actin cytoskeleton and in the formation of filopodia. EMBO J 1998;17:6527–40.
    OpenUrlAbstract
  22. 22.↵
    1. Baldus SE,
    2. Schaefer KL,
    3. Engers R,
    4. Hartleb D,
    5. Stoecklein NH,
    6. Gabbert HE
    . Prevalence and heterogeneity of KRAS, BRAF, and PIK3CA mutations in primary colorectal adenocarcinomas and their corresponding metastases. Clin Cancer Res 2010;16:790–9.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Li LH,
    2. Zheng MH,
    3. Luo Q,
    4. Ye Q,
    5. Feng B,
    6. Lu AG,
    7. et al.
    P21-activated protein kinase 1 induces colorectal cancer metastasis involving ERK activation and phosphorylation of FAK at Ser-910. Int J Oncol 2010;37:951–62.
    OpenUrlPubMed
  24. 24.↵
    1. Ong CC,
    2. Jubb AM,
    3. Zhou W,
    4. Haverty PM,
    5. Harris AL,
    6. Belvin M,
    7. et al.
    p21-activated kinase 1: PAK'ed with potential. Oncotarget 2011;2:491–6.
    OpenUrlPubMed
  25. 25.↵
    1. Kichina JV,
    2. Goc A,
    3. Al Husein B,
    4. Somanath PR,
    5. Kandel ES
    . PAK1 as a therapeutic target. Expert Opin Ther Targets 2010;14:703–25.
    OpenUrlCrossRefPubMed
  26. 26.↵
    1. Murray BW,
    2. Guo C,
    3. Piraino J,
    4. Westwick JK,
    5. Zhang C,
    6. Lamerdin J,
    7. et al.
    Small-molecule p21-activated kinase inhibitor PF-3758309 is a potent inhibitor of oncogenic signaling and tumor growth. Proc Natl Acad Sci U S A 2010;107:9446–51.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    1. Huynh N,
    2. Liu KH,
    3. Baldwin GS,
    4. He H
    . P21-activated kinase 1 stimulates colon cancer cell growth and migration/invasion via ERK- and AKT-dependent pathways. Biochim Biophys Acta 2010;1803:1106–13.
    OpenUrlCrossRefPubMed
  28. 28.↵
    1. He H,
    2. Huynh N,
    3. Liu KH,
    4. Malcontenti-Wilson C,
    5. Zhu J,
    6. Christophi C,
    7. et al.
    P-21 activated kinase 1 knockdown inhibits beta-catenin signalling and blocks colorectal cancer growth. Cancer Lett 2012;317:65–71.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Friedrich J,
    2. Seidel C,
    3. Ebner R,
    4. Kunz-Schughart LA
    . Spheroid-based drug screen: considerations and practical approach. Nat Protoc 2009;4:309–24.
    OpenUrlCrossRefPubMed
  30. 30.↵
    1. Kanwar SS,
    2. Yu Y,
    3. Nautiyal J,
    4. Patel BB,
    5. Majumdar AP
    . The Wnt/beta-catenin pathway regulates growth and maintenance of colonospheres. Mol Cancer 2010;9:212.
    OpenUrlCrossRefPubMed
  31. 31.↵
    1. Oltersdorf T,
    2. Elmore SW,
    3. Shoemaker AR,
    4. Armstrong RC,
    5. Augeri DJ,
    6. Belli BA,
    7. et al.
    An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature 2005;435:677–81.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Kang MH,
    2. Reynolds CP
    . Bcl-2 inhibitors: targeting mitochondrial apoptotic pathways in cancer therapy. Clin Cancer Res 2009;15:1126–32.
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Zhang HJ,
    2. Siu MK,
    3. Yeung MC,
    4. Jiang LL,
    5. Mak VC,
    6. Ngan HY,
    7. et al.
    Overexpressed PAK4 promotes proliferation, migration and invasion of choriocarcinoma. Carcinogenesis 2011;32:765–71.
    OpenUrlAbstract/FREE Full Text
  34. 34.↵
    1. Ahn HK,
    2. Jang J,
    3. Lee J,
    4. Se Hoon P,
    5. Park JO,
    6. Park YS,
    7. et al.
    P21-activated kinase 4 overexpression in metastatic gastric cancer patients. Transl Oncol 2011;4:345–9.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Shrestha Y,
    2. Schafer EJ,
    3. Boehm JS,
    4. Thomas SR,
    5. He F,
    6. Du J,
    7. et al.
    PAK1 is a breast cancer oncogene that coordinately activates MAPK and MET signaling. Oncogene 2012;31:3397–408.
    OpenUrlCrossRefPubMed
  36. 36.↵
    1. Liu F,
    2. Li X,
    3. Wang C,
    4. Cai X,
    5. Du Z,
    6. Xu H,
    7. et al.
    Downregulation of p21-activated kinase-1 inhibits the growth of gastric cancer cells involving cyclin B1. Int J Cancer 2009;125:2511–9.
    OpenUrlCrossRefPubMed
  37. 37.↵
    1. Baskaran Y,
    2. Ng YW,
    3. Selamat W,
    4. Ling FT,
    5. Manser E
    . Group I and II mammalian PAKs have different modes of activation by Cdc42. EMBO Rep 2012;13:653–9.
    OpenUrlCrossRefPubMed
  38. 38.↵
    1. Gnesutta N,
    2. Qu J,
    3. Minden A
    . The serine/threonine kinase PAK4 prevents caspase activation and protects cells from apoptosis. J Biol Chem 2001;276:14414–9.
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    1. Kumar R,
    2. Gururaj AE,
    3. Barnes CJ
    . p21-activated kinases in cancer. Nat Rev Cancer 2006;6:459–71.
    OpenUrlCrossRefPubMed
  40. 40.↵
    1. Park ER,
    2. Eblen ST,
    3. Catling AD
    . MEK1 activation by PAK: a novel mechanism. Cell Signal 2007;19:1488–96.
    OpenUrlCrossRefPubMed
  41. 41.↵
    1. Zhang J,
    2. Wang J,
    3. Guo Q,
    4. Wang Y,
    5. Zhou Y,
    6. Peng H,
    7. et al.
    LCH-7749944, a novel and potent p21-activated kinase 4 inhibitor, suppresses proliferation and invasion in human gastric cancer cells. Cancer Lett 2011;317:24–32.
    OpenUrlPubMed
  42. 42.↵
    1. Zang M,
    2. Hayne C,
    3. Luo Z
    . Interaction between active Pak1 and Raf-1 is necessary for phosphorylation and activation of Raf-1. J Biol Chem 2002;277:4395–405.
    OpenUrlAbstract/FREE Full Text
  43. 43.↵
    1. Koh W,
    2. Sachidanandam K,
    3. Stratman AN,
    4. Sacharidou A,
    5. Mayo AM,
    6. Murphy EA,
    7. et al.
    Formation of endothelial lumens requires a coordinated PKCepsilon-, Src-, Pak- and Raf-kinase-dependent signaling cascade downstream of Cdc42 activation. J Cell Sci 2009;122:1812–22.
    OpenUrlAbstract/FREE Full Text
  44. 44.↵
    1. Dan C,
    2. Kelly A,
    3. Bernard O,
    4. Minden A
    . Cytoskeletal changes regulated by the PAK4 serine/threonine kinase are mediated by LIM kinase 1 and cofilin. J Biol Chem 2001;276:32115–21.
    OpenUrlAbstract/FREE Full Text
  45. 45.↵
    1. Edwards DC,
    2. Sanders LC,
    3. Bokoch GM,
    4. Gill GN
    . Activation of LIM-kinase by Pak1 couples Rac/Cdc42 GTPase signalling to actin cytoskeletal dynamics. Nat Cell Biol 1999;1:253–9.
    OpenUrlCrossRefPubMed
Back to top
Molecular Cancer Research: 11 (2)
February 2013
Volume 11, Issue 2

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Email Article
Citation Tools
Knockdown of PAK4 or PAK1 Inhibits the Proliferation of Mutant KRAS Colon Cancer Cells Independently of RAF/MEK/ERK and PI3K/AKT Signaling
Hana Tabusa, Teresa Brooks and Andrew J. Massey
Mol Cancer Res February 1 2013 (11) (2) 109-121; DOI: 10.1158/1541-7786.MCR-12-0466
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Advertisement