Molecular Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Cancer Research 6, 614-623, April 1, 2008. doi: 10.1158/1541-7786.MCR-07-0262
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Google Scholar
Right arrow Articles by Elis, W.
Right arrow Articles by MacKeigan, J. P.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elis, W.
Right arrow Articles by MacKeigan, J. P.


Cell Cycle, Cell Death, and Senescence

Down-Regulation of Class II Phosphoinositide 3-Kinase {alpha} Expression below a Critical Threshold Induces Apoptotic Cell Death

Winfried Elis1, Ellen Triantafellow1, Natalie M. Wolters3, Katie R. Sian3, Giordano Caponigro2, Jason Borawski1, L. Alex Gaither1, Leon O. Murphy1, Peter M. Finan1 and Jeffrey P. MacKeigan3

1 Novartis Institutes for BioMedical Research, Developmental and Molecular Pathways; 2 Novartis Institutes for BioMedical Research, Oncology, Cambridge, Massachusetts and 3 Laboratory of Systems Biology, Van Andel Research Institute, Grand Rapids, Michigan

Requests for reprints: Jeffrey P. MacKeigan, Laboratory of Systems Biology, Van Andel Research Institute, 333 Bostwick Aveneu NE, Grand Rapids, MI 49503. Phone: 616-234-5682; Fax: 616-234-5733. E-mail: jeff.mackeigan{at}vai.org


    Abstract
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Members of the phosphoinositide 3-kinase (PI3K) family collectively control multiple cellular responses, including proliferation, growth, chemotaxis, and survival. These diverse effects can partly be attributed to the broad range of downstream effectors being regulated by the products of these lipid kinases, the 3'-phosphoinositides. However, an additional layer of complexity is introduced by the existence of multiple PI3K enzyme isoforms. Much has been learned over the last years on the roles of the classes I and III PI3K members in cellular signaling, but little is known about the isoform-specific tasks done by the class II PI3Ks (C2{alpha}, β, and {gamma}). In this study, we used quantitative reverse transcription–PCR and RNA interference in mammalian cells to gain further insight into the function of these lesser studied PI3K enzymes. We find that PI3K-C2{alpha}, but not PI3K-C2β, has an important role in controlling cell survival and by using a panel of RNA interference reagents, we were able to determine a critical threshold of PI3K-C2{alpha} mRNA levels, below which the apoptotic program is switched on, via the intrinsic cell death pathway. In addition, knockdown of PI3K-C2{alpha} to levels that by themselves do not induce apoptosis sensitize cells to the anticancer agent Taxol (paclitaxel). Lastly, we report that lowering the levels of PI3K-C2{alpha} in a number of cancer cell lines reduces their proliferation and cell viability, arguing that PI3K inhibitors targeting not only the class I{alpha} isoform but also class II{alpha} may contribute to an effective anticancer strategy. (Mol Cancer Res 2008;6(4):614–23)


    Introduction
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
The activation of phosphoinositide 3-kinases (PI3K) in response to extracellular stimuli and the subsequent generation of 3'-phosphorylated phosphoinositides as intracellular second messengers is a hallmark of many signaling pathways (1). This evolutionarily conserved family of enzymes can be classified into three groups according to their primary structure, regulation, and in vitro substrate specificity (2). The vast majority of studies conducted thus far have focused on class I and class III PI3Ks, which generate PtdIns-3,4,5-trisphosphate and PtdIns-3-monophosphate, respectively. In particular, they play important roles in growth factor signaling and amino acid sensing and are dysregulated in disease states, such as cancer and diabetes (3, 4).

Fewer reports exist on the role of class II PI3Ks in cellular signaling and disease. The three enzymes (C2{alpha}, C2β, and C2{gamma}) in this class are large molecules ranging from 166 to 190 kDa. PI3K-C2{alpha} and PI3K-C2β are widely expressed on the mRNA level, whereas expression of PI3K-C2{gamma} is mainly restricted to the liver, breast, and prostate (5, 6). In contrast to classes I and III PI3Ks, which are both dimeric enzymes whose enzymatic activities and subcellular localizations are regulated by various types of adaptor subunits, class II PI3Ks are monomeric enzymes with extended NH2 and COOH termini. These NH2 and COOH termini contain multiple protein and lipid interaction domains that target them to various intracellular membranes and the nucleus (7-9).

An increasing number of stimuli have been found to activate the class II {alpha}-isoforms and β-isoforms, including growth factors (e.g., insulin, epidermal growth factor, platelet-derived growth factor; refs. 10, 11), chemokines (e.g., MCP-1; ref. 12), tumor necrosis factor-{alpha}, leptin (13), and lysophosphatidic acid (14), but the precise mechanism by which most of these upstream signals are actually transmitted to the enzymes and stimulate their lipid kinase activity in vivo still remains to be elucidated. Furthermore, whereas class II PI3Ks have been reported to use PtdIns and PtdIns-4-P in vitro, it is still controversial which of these lipids are used as substrates in vivo (15). Accordingly, little is known on potential downstream effectors of class II PI3Ks. Only recently have cellular roles been investigated for the β-isoform in cell migration (14, 16, 17) and the {alpha}-isoform in the regulation of vascular smooth muscle contraction (18).

The presence of class II PI3Ks in multiple cellular compartments (6), as well as the tight regulation of PI3K-C2{alpha} expression and stability (19), argues for additional functions of these enzymes in cellular signal transduction. Furthermore, PI3K-C2{alpha} and PI3K-Cβ have been shown to be highly expressed in small cell lung carcinomas, with the β-isoform contributing to epidermal growth factor–mediated phosphorylation of Akt/PKB in these cells (20), raising the question of whether these lipid kinases might be involved in the regulation of cellular proliferation and survival. Indeed, one study recently suggested that abrogation of PI3K-C2{alpha} expression in Chinese hamster ovary–insulin receptor expressing cells leads to apoptotic cell death (21); however, concerns over the experimental approach, which included the use of a small number of sense and antisense oligonucleotides with limited sequence specificity in only one cell type, as well as contradictory results reported by other groups, questioned the relevance of these findings (6, 14).

We therefore initiated a study to comprehensively analyze the potential roles of PI3K-C2{alpha} and PI3K-C2β in cell survival. To this end, we used a panel of isoform-specific short interfering RNA (siRNA) sequences at low nanomolar concentrations and assessed their efficiency in knocking down expression of PI3K-C2{alpha} and PI3K-C2β, as well as any effect this might have on cell viability. We find that PI3K-C2{alpha}, but not PI3K-C2β, has an important role in controlling cell survival via the intrinsic cell death pathway. We were also able to quantitatively determine the critical threshold of PI3K-C2{alpha} inhibition, below which the apoptotic program is switched on, and further found that at levels above this threshold, cells are sensitized to undergo apoptosis upon exposure to the conventional chemotherapeutic agent Taxol. We expanded our findings to twenty-three additional cancer cell lines and determined that more than half of them show a significant reduction in cell proliferation and viability upon knockdown of PI3K-C2{alpha}. Our results therefore indicate that in addition to the inhibition of the class I{alpha} isoform, interference with PI3K-C2{alpha} activity might contribute to an effective anticancer strategy in a subset of cancers.


    Results
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
PI3K Isoform Expression Profile
The three classes of human PI3K are composed of eight different catalytic subunits: class I (C1{alpha}, C1β, C1{gamma}, C1{delta}), class II (C2{alpha}, C2β, C2{gamma}), and class III (C3 or Vps34). Although expression of some of these enzymes can be restricted to specific cells, most cell types coexpress multiple isoforms (22). The expression profile of all eight isoforms relative to one another has not been shown, and we therefore did real-time quantitative reverse transcription–PCR (qRT-PCR) to determine their relative mRNA levels in HeLa cells (Fig. 1A ) and U2OS cells (data not shown). In HeLa cells, the class Iβ, class II{alpha}, and class III isoforms were the predominantly expressed PI3K family members. Remarkably, transcript levels for C2{alpha} were six times higher than those for C1{alpha} and 33% higher than those for C1β. In addition, the C1β (or p110β) isoform is four times more abundant than the frequently mutated and widely studied C1{alpha} (or p110{alpha}) isoform (23). qRT-PCR in U2OS cells showed that C2{alpha} was again the most abundant PI3K isoform, with mRNA levels 2-fold higher than for C1β or C1{delta} and 10-fold higher than for C1{alpha}. Our results in both cell lines also highlight the restricted expression profile of the PI3K{gamma} isoforms (C1{gamma} and C2{gamma}), which are mainly found in cells of hematopoietic origin in the case of C1{gamma} (24) and liver, breast, and prostate for C2{gamma} (22, 25-27).


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 1. PI3K class II {alpha} inhibition leads to decreased cell viability in HeLa cells. A. PI3K isoform expression in HeLa cells. Total RNA was isolated, and primers are designed to specifically amplify each of the indicated PI3K classes I, II, and III isoforms. Expression levels were determined using qRT-PCR and comparative Ct method for relative mRNA expression to PPIA. B. Real-time qRT-PCR knockdown analysis using C2{alpha} siRNA duplexes. HeLa cells were transfected with two different siRNA duplexes (25 nmol/L) directed against C2{alpha}, and target knockdown was measured by qRT-PCR. C. TUNEL analysis of cell death. HeLa cells were transfected with either control siRNA or two individual C2{alpha} siRNA duplexes (25 nmol/L) as indicated. After 72 h of C2{alpha} knockdown, the cells were examined for cell viability by phase contrast and the level of apoptosis determined by TUNEL staining.

 
Inhibition of PI3K-C2{alpha} Function Leads to Apoptosis via the Intrinsic Cell Death Pathway
To better understand the function of the highly expressed C2{alpha} isoform, we transfected HeLa cells with two siRNAs that target unique regions of C2{alpha}. Under conditions of >99% transfection efficiency (28), the degree of mRNA knockdown was measured by qRT-PCR, and the physiologic consequences were assessed. Treatment of cells with the isoform-specific C2{alpha}-1 and C2{alpha}-2 siRNAs resulted in 85% and 86% knockdown of C2{alpha} transcript levels, respectively (Fig. 1B), resulting in a dramatic decrease in cell viability and increase in apoptosis with 52% and 46% of the cells being TUNEL positive as measured by flow cytometry (Fig. 1C and Table 1 ).


View this table:
[in this window]
[in a new window]

 
Table 1. Time Course of PI3K-C2{alpha} siRNA-Mediated Apoptosis

 
To further characterize these effects on a molecular level, we used the siRNA duplexes to target and knockdown PI3K-C2{alpha} in HeLa cells and measured the cleavage of poly(ADP-ribose) polymerase (PARP) as a hallmark of apoptosis. In accordance with the observed decrease in cell viability, down-regulation of C2{alpha} resulted in an increase in the amount of cleaved PARP relative to that in control cells (Fig. 2A ) starting as early as 24 hours after siRNA treatment (Fig. 2B). We also investigated whether any of the initiator caspases were involved in the sequence of events that lead to apoptosis upon knockdown of PI3K-C2{alpha} and found that caspase-9 is strongly activated under these conditions and with the same kinetics as PARP cleavage (Fig. 2A and B), indicating a role for the intrinsic cell death pathway that is being activated by various intracellular stresses (29). This was further corroborated by the fact that siRNA-mediated knockdown of the downstream proapoptotic members Bax and Bak resulted in a dramatic suppression of the PI3K-C2{alpha} loss of function phenotype (Fig. 2C), implying that ablation of this lipid kinase constitutes intracellular stress leading to mitochondrial dependent apoptosis. This is also supported by the observation that signaling pathways which relay extrinsic signals emanating from cell surface receptors to the interior of the cell via Akt or GSK-3 are unaffected by the knockdown of PI3K-C2{alpha} (Fig. 2D).


Figure 2
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 2. Knockdown of PI3K class II {alpha} leads to apoptosis via the intrinsic pathway. A. Activated caspase-9 and the caspase substrate PARP were detected by Western blot analysis. HeLa cells were transfected with either control or two individual C2{alpha} siRNAs (25 nmol/L) for 72 h and immunoblotted for PI3K-C2{alpha} knockdown, cleaved PARP, and caspase-9 activation. B. Kinetics of PI3K-C2{alpha} knockdown, caspase-9 activation, and cleaved PARP. C. Knockdown of proapoptotic factors Bax and Bak enhances survival of cells with depleted PI3K-C2{alpha} levels. HeLa cells were cotransfected with either siRNAs against C2{alpha} or Bax/Bak or cotransfected with all three siRNAs, and cell viability was measured after 72 h. D. Knockdown of PI3K-C2{alpha} does not affect the PI3K class I/Akt cell survival pathway. HeLa cells were transfected with either control or two individual C2{alpha} siRNAs (25 nmol/L) and immunoblotted for PI3K-C2{alpha} knockdown, phosphorylated Akt (S473), Akt, phosphorylated Gsk-3{alpha}/β (S21/9), and Gsk-3β at the indicated time points (36 or 48 h) after siRNA transfection.

 
C2{alpha} RNA Interference–Induced Apoptosis Is Specific to C2{alpha} Down-Regulation
Although RNA interference (RNAi) is a powerful research tool for selectively silencing the target mRNA and the protein encoded, it is imperative to follow-up initial observations made using a limited number of siRNAs with additional siRNAs to confidently understand the function of a single gene product (30). With this in mind, we used a total of six unique C2{alpha} siRNA sequences in a DNA fragmentation assay as another hallmark of apoptosis to exclude the possibility of off-target effects contributing to our observations. Again, each of the six individual C2{alpha} siRNAs exhibited a significant increase in apoptosis over control (scrambled) siRNA (Fig. 3A ).


Figure 3
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 3. Induction of apoptosis is due to specific knockdown of PI3K class II {alpha} expression. A. Apoptosis confirmed with multiple siRNA duplexes directed against C2{alpha}. HeLa cells seeded in 96-well plates were transfected with control (scrambled) siRNA or six unique C2{alpha} siRNA duplexes. Cells were incubated for 72 h to allow for target knockdown, and apoptosis was measured by a DNA-fragmentation ELISA. Basal apoptosis is set at one and relative apoptosis for the six C2{alpha} siRNA duplexes was determined. B. C2{alpha} siRNA dose-response curve. HeLa cells were transfected with 0, 1, 5, or 10 nmol/L C2{alpha}-1 siRNA duplex and apoptosis measured as indicated above. C. Measurement of C2{alpha} siRNA off-target effects on PI3K family members using qRT-PCR. HeLa cells were transfected with either C2{alpha}-1 siRNA or control siRNA duplexes, total RNA was isolated, and primers were used to specifically amplify each of the indicated PI3K classes I, II, and III isoforms. Expression was determined using qRT-PCR and comparative Ct method for relative mRNA expression to glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

 
Besides using multiple siRNA duplexes to corroborate our observations, we also wanted to establish the lowest effective siRNA concentration to rule out potential off-target effects. To this end, we selected the most potent siRNA (C2{alpha}-1) from our panel of C2{alpha} siRNAs, titrated in the amount of siRNA from 1 to 10 nmol/L, and again did the ELISA for histone-DNA fragmentation. The level of mRNA knockdown with 1, 5, and 10 nmol/L C2{alpha}-1 siRNA was 57%, 75%, and 80%, respectively, with a concomitant increase in apoptotic cell death (Fig. 3B). Importantly, the apoptotic phenotype correlates with the degree of C2{alpha} suppression. From these and earlier experiments, we have determined a 25 nmol/L concentration of C2{alpha} siRNA, corresponding to an 85% knockdown, as the lowest effective C2{alpha} siRNA concentration which gives a maximal C2{alpha} suppression.

Lastly, we wanted to determine whether the C2{alpha} siRNAs were having any off-target effects on other PI3K family members due to partial sequence conservation that might account for the apoptotic phenotype. Thus, HeLa cells were transfected with C2{alpha}-1 siRNA at 25 nmol/L for 30 hours, and transcript levels of each PI3K isoform were measured. As shown in Fig. 3C, levels of all PI3K isoforms expressed in HeLa cells remained virtually unchanged in the presence of C2{alpha}-1 siRNA, whereas the level of C2{alpha} mRNA is dramatically reduced. Note that there is a slight decrease in the PI3K-C1β mRNA level with the C2{alpha}-1 siRNA. However, using four specific C1β siRNAs that each knockdown mRNA levels by 90%, 87%, 91%, and 88%, we did not observe any effect on cell viability, indicating that the apoptosis phenotype observed is a result of selective PI3K-C2{alpha} reduction and not due to some off-target effect on PI3K-C1β. Furthermore, knockdown of mRNA levels of additional PI3K isoforms (C1{alpha}, C1{delta}, and C3) with siRNAs neither displayed off-target effects with regard to PI3K-C2{alpha} transcript levels nor did these siRNAs induce cell death.

Critical Threshold of C2{alpha} Reduction Required for Apoptosis
It is well-established that the levels of signaling proteins within a cell play an important role in setting the threshold for their action in many cellular functions, including apoptosis. However, whereas class I PI3K-specific inhibitors have been described, no class II PI3K-specific compounds exist which could be used to investigate whether cells can be sensitized to apoptosis by inhibiting PI3K-C2{alpha} function (6, 31). The use of two common PI3K inhibitors, LY294002 and wortmannin, has identified class I PI3Ks as playing an important role in cell survival signaling. Many studies seem to attribute the effects of these pan-PI3K inhibitors to the inhibition of class I PI3K alone, although the sensitivity of PI3K-C2β and PI3K-C2{gamma} to these inhibitors is similar to that of human class I and class III PI3Ks (32). Furthermore, many studies use compound concentrations far higher than normal for class I PI3K inhibition, which begin to inhibit even the more resistant PI3K-C2{alpha} enzyme (33).

We therefore investigated whether we could establish a threshold of PI3K-C2{alpha} inhibition and determine whether HeLa cells could be "sensitized" to undergo apoptosis. To achieve this, we used three cell lines stably expressing different C2{alpha} short hairpin RNAs (shRNA; ref. 34). The shRNAs used reduced PI3K-C2{alpha} mRNA and protein levels to varying degrees (Fig. 4A ). We then titrated varying amounts of C2{alpha}-1 siRNA (1-25 nmol/L) and did the DNA fragmentation ELISA. At the lowest dose (1 nmol/L), the mRNA level for PI3K-C2{alpha} in control cells was reduced by >50%, although we did not observe any increase in apoptosis (>2-fold increase). However, at 5 nmol/L or higher of C2{alpha}-1 siRNA, transcript levels were reduced by 75% and cell death could be observed (Fig. 4B and C). In the shRNA-1 sensitized cells, the basal level of apoptosis was already higher than in control cells and similar to the extent of apoptosis observable after treatment of these control cells with 5 nmol/L C2{alpha}-1 siRNA. In addition, exposure of the sensitized HeLa cells to as little as 5 or 10 nmol/L of C2{alpha}-1 siRNA further decreased cellular viability (Fig. 4C). We also tested whether cells with reduced levels of PI3K-C2{alpha} are more sensitive to conventional chemotherapeutics and found that a combination of Taxol and PI3K-C2{alpha} knockdown is much more potent than Taxol alone (Fig. 4D). Taken together, these results show that a decrease in PI3K-C2{alpha} expression sensitizes cells to undergo apoptosis, with a target knockdown of ≥75% required to switch-on apoptosis in all C2{alpha} RNAi-sensitized cell lines tested.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 4. Critical threshold of C2{alpha} target inhibition required to switch on apoptosis. A. HeLa cells were infected with either control or three different C2{alpha} shRNA-encoding lentiviruses and PI3K C2{alpha} protein levels were detected by Western blot analysis. B. Control or C2{alpha} shRNA-1 expressing cells were incubated with C2{alpha}-1 siRNA (0, 1, 5, 10, or 25 nmol/L) to measure target knockdown by qRT-PCR and apoptosis by a DNA fragmentation ELISA. Expression was determined using qRT-PCR and comparative Ct method for relative mRNA expression to PPIA. *, indicates >2-fold DNA fragmentation relative to control cells. C. C2{alpha} shRNA suppression sensitizes cells to low nanomolar C2{alpha} siRNA-induced apoptosis. HeLa cells were infected with either control or C2{alpha} shRNA-1 virus followed by increasing concentrations of C2{alpha}-1 siRNA, and apoptosis was measured by ELISA. D. PI3K-C2{alpha} siRNA sensitizes cells to the chemotherapeutic agent Taxol (paclitaxel). HeLa cells were transfected with suboptimal levels of C2{alpha}-1 siRNA (0, 1, or 5 nmol/L) for 48 h and then treated with increasing concentrations of Taxol (0, 1.25, 2.5, 5, or 10 nmol/L) for an additional 24 h, and percentage of cell death was measured.

 
Depletion of C2β Does Not Induce Apoptosis
The class II PI3Ks are large monomeric enzymes with similar domain structures and in vitro substrate specificity. Unlike other PI3Ks, which were identified based on their cellular function, all three class II PI3K members were identified through lipid kinase domain homology searches and cloned by PCR due to the presence of C2 and PX domains at their carboxyl terminus (25-27, 33). To investigate whether the other ubiquitously expressed C2 enzyme, C2β, may have a role similar to that of C2{alpha} in regulating cell survival, four different siRNA duplexes against C2β were used to knockdown mRNA levels in HeLa cells. Each siRNA effectively suppressed both mRNA transcript (Fig. 5A ) and protein levels (Fig. 5B), but had no effect on cell viability as measured by DNA fragmentation ELISA (Fig. 5C). Thus, our findings, as well as those of other research groups, suggest that the PI3K isoforms C2{alpha} and C2β have distinct functional roles in cells. Indeed, although both isoforms are highly conserved, they also contain divergent NH2 terminal regions that may account for isoform-specific protein-protein interactions, resulting in distinct roles in cellular signaling. These data show that the {alpha}-isoform of class II PI3K, but not the β-isoform, is an important survival kinase.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 5. C2β does not have a functional role in apoptosis. A and B. qRT-PCR and Western blot analysis of C2β siRNA duplexes. HeLa cells were transfected with four different siRNAs (25 nmol/L) directed against C2β or control siRNA. Total RNA was isolated 30 h after transfection to measure C2β mRNA levels and cell lysates were generated after 72 h for C2β Western blot analysis. C. Suppression of C2β does not result in apoptosis. Apoptosis was measured 72 h after C2{alpha} or C2β siRNA transfection by ELISA that detects DNA-histone fragmentation, and the data are expressed as fold increase in absorbance relative to control-treated cells.

 
PI3K-C2{alpha} Is Required for Cell Survival in Many Cancer Cell Lines
Having established that PI3K-C2{alpha} plays an isoform-specific role in cellular survival in at least HeLa cells, we wanted to determine whether this is a general hallmark of cancer lines. To further investigate this question, 23 cancer cell lines from bladder, breast, brain, colon, kidney, liver, lung, ovarian, pancreas, prostate, skin, and thyroid carcinomas were infected with a PI3K-C2{alpha} shRNA lentivirus (C2{alpha}-shRNA). The C2{alpha}-shRNA potently reduces PI3K-C2{alpha} mRNA levels, and the effects on cell viability were measured (Table 2 ). As expected, not all of the cancer cell lines tested were equally susceptible to the down-regulation of PI3K-C2{alpha}. Importantly, more than half (13 of 23) of them showed a reduction of 50% or more in cell survival when compared with the parental cell line that was infected with a scrambled shRNA control lentivirus. In total, 21 of 23 cell lines from various tumor types had decreased cell viability to some extent after PI3K-C2{alpha} RNAi-mediated down-regulation. However, sensitivity to reduced levels of PI3K-C2{alpha} was also apparent in one of the normal cell lines tested (human umbilical vascular endothelial cell), but not in two additional cell lines, normal human bladder smooth muscle cells, and human lung epithelial fibroblast (WI-38) cells (Fig. 6B ). This raises the possibility that C2{alpha} may have a tissue specific role in the survival of endothelial cells and carcinoma cells. Indeed, these data confirm and extend our previous observations to show that PI3K-C2{alpha} is required for cell survival in a large number of carcinoma cell lines.


View this table:
[in this window]
[in a new window]

 
Table 2. Cell Viability and Knockdown of Carcinoma Cell Lines after PI3K-C2{alpha} RNAi

 

Figure 6
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 6. Susceptibility of carcinoma and normal cell lines to knockdown of PI3K-C2{alpha}. A Heatmap depicting cell viability of twenty-three carcinoma cell lines following P13K-C2{alpha} RNAi. Decreased cell viability compared with nontargeting control shRNA is in red and those unchanged or up-regulated are in green. The cell viability/proliferation assay is a measurement of the change in cell number over either a 5-d or 9-d period. Numbers given represent percentage of viability of C2{alpha} shRNA-infected cells compared with cells that were infected with a virus expressing a nontargeting control shRNA (Table 2). Percentages of knockdown of PI3K-C2{alpha} mRNA levels are indicated where available (Table 2). B Human umbilical vein endothelial cells (HUVEC), human bladder smooth muscle cells (BdSMC), and human lung epithelial fibroblast cell lines (WI-38) were transfected with 25 nmol/L of either control siRNA or two individual C2{alpha} siRNA duplexes, and cell viability was measured. In a parallel experiment, PI3K-C2{alpha} protein levels were detected by Western blot analysis after 72 h of C2{alpha} knockdown.

 

    Discussion
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Previous studies have shown that class II PI3Ks act downstream of several growth factors (10, 11) and chemokines (12), but the cellular responses that are controlled by these lipid kinases have only slowly begun to emerge. Thus far, both PI3K-C2{alpha} and PI3K-C2β have been implicated in the regulation of membrane trafficking (9, 35), whereas the β-isoform has been described to play an additional isoform-specific role in cellular migration (14). PI3K-C2{alpha} has also been found to be rapidly degraded in proliferating cells upon exposure to genotoxic stress and at the G2-M transition during the cell cycle (19), leading to speculation that class II PI3Ks could be involved in the regulation of cellular proliferation or survival. Indeed, earlier reports had shown that the β-isoform is activated by insulin (10), an important growth factor, and in turn plays a role in the regulation of Akt/PKB (20), a known survival kinase.

In this study, we investigated the effect of ablation of expression of the class II PI3Ks on cell viability, and our results identify PI3K-C2{alpha} as a crucial cellular survival factor. Whereas HeLa cells can tolerate a strong decrease in the expression of the β-isoform, a reduction in the {alpha}-isoform by 75% is sufficient to induce apoptosis. Furthermore, our study indicates that PI3K-C2{alpha} fulfills this crucial role not only in HeLa cells, but also in a significant number of cancer cell lines from various organs and tumor stages. At the same time, the human umbilical vein endothelial cells are susceptible to low levels of PI3K-C2{alpha} whereas the human bladder smooth muscle cells and human lung epithelial fibroblast cell lines (WI-38) cells are not, so clearly other factors exist that can be exploited in certain cancer contexts. The cellular mechanism by which PI3K-C2{alpha} contributes to cell survival is thus far unknown, but seems to involve suppressing or countering caspase-9 activation, thus potentially linking PI3K-C2{alpha} to the intrinsic cell death pathway and mitochondrial integrity. Interestingly, the presence of several other class IA and class III PI3K family members is not sufficient to protect the cells from the effects of PI3K-C2{alpha} down-regulation, arguing for an important and specific role of this lipid kinase in cell survival.

Our findings fit nicely with the observations made by other groups that expression of PI3K-C2{alpha} is not only highly regulated in time (i.e., during the cell cycle and upon exposure of cells to genotoxic stress), but also in space (as evidenced by the existence of distinct cytoplasmic and nuclear compartments; refs. 7, 19). Indeed, it is probably this tight regulation that blocked our attempts, as well as those of other groups, to stably express exogenous protein (19), which would have allowed us to undertake a rescue experiment designed to save cells from apoptosis that were treated with siRNAs directed against the 3' untranslated region of the mRNA coding for PI3K-C2{alpha}. Nevertheless, through the identification of several different siRNAs that at low nanomolar levels were able to abolish both mRNA and protein levels as well as the use of shRNAs that either sensitized cells to siRNA-induced apoptosis or caused cell death themselves, we have increased the likelihood that the apoptotic phenotype we observe can be attributed to on-target down-regulation of PI3K-C2{alpha} and not to an off-target effect on some other factor.

Similar to the three class IA PI3Ks, it is thus far unknown why many cells coexpress at least two class II PI3Ks. PI3K-C2{alpha} and PI3K-C2β show many similarities in their primary structure. The human proteins are 44% identical and 71% similar on the amino acid sequence level, although these numbers are only 19% and 47% in the first 400 amino acids, respectively. The same can be said for their domain structure and subcellular localization, which helps to explain their overlapping function in membrane trafficking. At the same time, the sequence differences have the potential to also link the two isoforms to different signaling pathways, thus accounting for their nonredundant roles in cell survival and migration.

The identification of class II PI3Ks as key players in cellular functions ranging from cell migration and vascular smooth muscle contraction to cell survival merits follow-up studies aimed at identifying the factors acting immediately upstream and downstream of these lipid kinases, as well as characterizing the domains responsible for these interactions. It is also worth keeping in mind that these functions of class II PI3Ks might not merely rely on their lipid kinase activity, because PI3K-C2{alpha} and PI3K-C2β are large enzymes that could also serve as platforms for the assembly of protein complexes. Together, such studies will not only shed light on the mechanisms by which class II PI3Ks contribute to the above-mentioned cellular functions, but they might also uncover novel roles for these long-neglected lipid kinases in cell signaling.


    Materials and Methods
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Cell Culture
HeLa, A2058, A549, MDA-MB-468, PC-3, RKO, SW579, and T24 cells were maintained in DMEM, HEPG2, J82, SK-HEP-1, and U-87MG cells were cultured in Eagle's MEM; Mia PaCa-2 cells were grown in DMEM containing glutamax; and 786-O, A-375, BxPC-3, DU145, HCT116, HT-29, MDA-MB-231, NCI-H1299, NCI-H838, and SK-OV-3 cells were maintained in RPMI 1640 and supplemented with 10% heat-inactivated fetal bovine serum. LN-18 cells were cultured in DMEM supplemented with 5% fetal bovine serum. Human umbilical vein endothelial cells were grown in EGM-2, bladder smooth muscle cell in SmGM2, and WI-38 in DMEM with 10% fetal bovine serum and nonessential amino acids.

RNAi Sequences
The siRNA sequences were synthesized by Dharmacon or Qiagen as 21-mer oligoribonucleotides with a 19-bp duplex region and two deoxynucleotide overhangs on the 3' terminus of each strand. The Dharmacon siRNA sequences are a set of four siGENOME duplexes (MQ-006771-00-0020 for PIK3C2A and MQ-006772-00-0020 for PIK3C2B). The Qiagen siRNA sequence design uses a BIOPREDsi potency predictor algorithm to score 21-mer oligoribonucleotides (36).

The cDNA sequences against which siRNAs were prepared are C2{alpha}-1 (agaggaagtgctgcagaataa), C2{alpha}-2 (ttgaagagagatcgacagcaa), C2{alpha}-3 (aaggatttcagctaccagtta), C2{alpha}-4 (cacaaggaagcttacctatct), C2{alpha}-5 (cagaatcagtaaagaagctaa), C2{alpha}-6 (ccagaacttacaagtattcaa), C2β-1 (tggccggaagcttctgggttt), C2β-2 (gacatcaacactttctctttg), C2β-3 (ctcaagagctctggccgaatc), and C2β-4 (atgctgagaccctgcgtaaga).

shRNA clones containing the following sequences coding for shRNAs against PIK3C2A were obtained from The RNAi Consortium: shRNA-1 (ccggccacttatgctttaccttctactcgagtagaaggtaaagcataagtggttttt) TRCN0000002228, shRNA-2 (ccgggctagtgtgaaggtctccattctcgagaatggagaccttcacactagcttttt) TRCN0000002229, shRNA-3 (ccggcaaagaagtatggaacgagtactcgagtactcgttccatacttctttgttttt) TRCN0000002231, shRNA-4 (ccggcgagcagtagatcaagtaattctcgagaattacttgatctactgctcgttttt) TRCN0000002230.

siRNA Transfection and shRNA Infection
For siRNA transfection, HeLa and U2OS cells (2 x 105) were cultured in six-well plates for 24 h and transfected with siRNA duplexes using Oligofectamine (Invitrogen) at the indicated concentrations. Cells were lysed after 30 h for RNA isolation and after 72 h for protein levels. shRNA lentivirus production and infection conditions for HeLa cells were optimized in six-well plates (34, 37). Cells were seeded at a density of 2 x 105 per well in a six-well plate, incubated for 24 h, infected using 1 mL of shRNA lentiviral supernatant, and incubated for 7 d and more using 2 µg/mL puromycin selection. Viral supernatants for all other cell lines were produced in 293T cells using a modified version of the three plasmid transfection protocols described in (refs. 38, 39). Briefly, 293T cells were transfected with a mixture of two helper plasmids, pVSV-G (40) and pCMV{Delta}R8.9 (39), and the specific pLKO-shRNA expressing vector (34) along with Transit-293 lipid transfection reagent (Mirus). After 18 to 24 h, the medium was replaced, and after an additional 72h, supernatants containing viral particles were harvested, filtered through 0.45 µmol/L cellulose-acetate and filtrates frozen down at –80°C until use. Cells to be infected were plated in black-sided clear-bottomed 96-well plates at densities ranging from 500 to 4,000 cells per well depending on the particular cell type 18 to 24 before infection with virus. Infections were done in 200 µL of media supplemented with 8 µg/mL polybrene at 37°C and 5% CO2 for 4 h using between 0.1 and 2.0 µL of titer-normalized viral supernatant/well depending on the particular cell type. Medium was replaced 12 to 24 h later with 100 µL fresh medium and puromycin added to the wells after an additional 12 to 24 h (final concentration, 0.5-2.0 µg/mL).

Real-time qRT-PCR
Total RNA was extracted 30 h after siRNA transfection and purified using the RNeasy mini kit (Qiagen). Subsequent cDNA synthesis was done using the StrataScript first strand cDNA synthesis kit (Stratagene). For real-time qRT-PCR, 81 ng of total cDNA was mixed with 10 µL of 2x Taqman Universal PCR master mix (Applied Biosystems) and 1 µL of 20x Taqman gene expression assay (Applied Biosystems; see below for respective catalogue number) in a total volume of 20 µL. Also included were no template controls and no reverse transcriptase controls preceding cDNA synthesis step to check for contamination by genomic DNA. Samples were analyzed in a 384-well plate using the ABI Prism 7900HT with the following cycling variables: (a) 50°C for 2 min, (b) 95°C for 10 min, (c) 95°C for 15 s, (d) 60°C for 1 min, repeat steps 3 to 4 for a total of 40 times. Each reaction was run in triplicate, with cyclophilin A (PPIA) or glyceraldehyde-3-phosphate dehydrogenase used as endogenous controls. The samples were then analyzed using default settings (background: cycles 3-15, threshold set at 0.2), and a comparative Ct method was used to obtain relative copy numbers. The following Taqman gene expression assays were acquired from Applied Biosystems: PI3KC1{alpha} (Hs00180679_m1), PI3KC1β (Hs00178872_m1), PI3KC1{delta} (Hs00192399_m1), PI3KC1{gamma} (Hs00176916_m1), PI3KC2{alpha} (Hs00153223_m1), PI3KC2β (Hs00153248_m1), PI3KC2{gamma} (Hs00362135_m1), PI3KC3 (Hs00176908_m1), PPIA (Hs99999904_m1), and glyceraldehyde-3-phosphate dehydrogenase (Hs99999905_m1).

TUNEL Analysis
Floating and adherent cells were collected, washed in PBS, and fixed in 1% paraformaldehyde followed by 70% ethanol. Cells were washed and DNA breaks were incubated in DNA labeling solution containing TdT and bromo-dUTP at 37°C for 60 min. Cells were then incubated for 30 min with anti-BrdUrd FITC-conjugated antibody (Becton Dickinson), washed in 0.5% Tween 20 plus 1% bovine serum albumin in PBS, resuspended in propidium iodide stain buffer (0.5% Tween 20, 250 µg/mL DNase-free RNase A, 20 µg/mL propidium iodide). After staining, samples were analyzed by fluorescence-activated cell sorting with a FACScan flow cytometer (Becton Dickinson), and data were acquired and analyzed with CellQuest software (Becton Dickinson Immunocytometry Systems).

Apoptosis ELISA
HeLa cells seeded 24 h earlier in 96-well plates (3,000 per well) were transfected with the indicated siRNAs. In each siRNA experiment, scrambled siRNA duplexes were used as negative controls. After 72 h of target knockdown, quantification of apoptotic cell death was determined by an ELISA that measures cytoplasmic histone-DNA fragments produced during apoptosis (Roche). The 96-well plates were centrifuged (200 x g) for 10 min, the supernatants were discarded, and lysis buffer was added. After lysis, the samples were centrifuged and 20 µL of the supernatant were transferred to a strepavidin-coated microtiter plate. Anti-histone biotin and anti-DNA peroxidase antibodies were added to each well, and the plate was incubated at room temperature for 2 h. After three washes with buffer, the peroxidase substrate was added to each well. After 10-min incubation, the plates were read at 405 nm in a microplate reader. The enrichment of histone-DNA fragments is expressed as fold increase in absorbance compared with control (nonsilencing) siRNA.

Cell Viability Assay
To determine growth of the various cell lines after knockdown of PIK3C2{alpha}, relative cell number was measured at two different times using Cell Titer Glo or Cell Titer Blue (Promega) according to the manufacturer's instructions. The initial measurement of cell number was taken 72 h after the addition of puromycin, once uninfected cells had been removed via selection. The second measurement was taken either 5 or 9 d after the initial measurement, once control cells had doubled three to five times. For experiments using siRNAs, relative cell number was quantified 72 h after target knockdown. All luminescence measurements were taken using an Envision plate reader (Perkin-Elmer) and were done on three replicate wells. For each infection, the fold change in cell number over the time course was determined by calculating the ratio of the first and second cell number measurements and comparing it to the ratio obtained for cells infected with a virus encoding a nontargeting shRNA.

Cell Lysis and Immunoblotting
Cell extracts were prepared by washing cells in ice-cold PBS and harvesting in lysis buffer (pH 7.2; 10 mmol/L KPO4, 1 mmol/L EDTA, 10 mmol/L MgCl2, 50 mmol/L β-glycerophosphate, 5 mmol/L EGTA, 0.5% NP40, 0.1% Brij-35, 1 mmol/L sodium orthovanadate, 40 µg/mL phenylmethylsulfonyl fluoride, 10 µg/mL leupeptin, 5 µg/mL pepstatin A). Extracts were centrifuged at 15,000 rpm for 10 min at 4°C, and cell lysates were immunoblotted using standard procedures using anti-PI3K p170, anti-PI3K class II β, anti-GSK-3β (BD Biosciences), anti-PARP, anti-caspase-9, anti-pGSK3{alpha}/β(S21/9), anti-Akt, and anti-pAkt(S473) (Cell Signaling Technology), and anti-tubulin (Sigma) antibodies.


    Acknowledgements
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
We thank Henry Wang, Maxime Magnier, Mailin Van Hoosear, David Nadziejka, and Brendan Looyenga for helpful comments and discussions.


    Notes
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: W. Elis and E. Triantafellow contributed equally to this work.

Received 6/ 6/07; revised 12/ 3/07; accepted 12/19/07.


    References
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 

  1. Shaw RJ, Cantley LC. Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature 2006;441:424–30.[CrossRef][Medline]
  2. Engelman JA, Luo J, Cantley LC. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet 2006;7:606–19.[CrossRef][Medline]
  3. Vanhaesebroeck B, Leevers SJ, Ahmadi K, et al. Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem 2001;70:535–602.[CrossRef][Medline]
  4. Wymann MP, Marone R. Phosphoinositide 3-kinase in disease: timing, location, and scaffolding. Curr Opin Cell Biol 2005;17:141–9.[CrossRef][Medline]
  5. El Sheikh SS, Domin J, Tomtitchong P, Abel P, Stamp G, Lalani EN. Topographical expression of class IA, class II. phosphoinositide 3-kinase enzymes in normal human tissues is consistent with a role in differentiation. BMC Clin Pathol 2003;3:4.[CrossRef][Medline]
  6. Traer CJ, Foster FM, Abraham SM, Fry MJ. Are class II phosphoinositide 3-kinases potential targets for anticancer therapies? Bull Cancer 2006;93:E53–8.[Medline]
  7. Didichenko SA, Thelen M. Phosphatidylinositol 3-kinase c2{alpha} contains a nuclear localization sequence and associates with nuclear speckles. J Biol Chem 2001;276:48135–42.[Abstract/Free Full Text]
  8. Meunier FA, Osborne SL, Hammond GR, et al. Phosphatidylinositol 3-kinase C2{alpha} is essential for ATP-dependent priming of neurosecretory granule exocytosis. Mol Biol Cell 2005;16:4841–51.[Abstract/Free Full Text]
  9. Wheeler M, Domin J. The N-terminus of phosphoinositide 3-kinase-C2β regulates lipid kinase activity and binding to clathrin. J Cell Physiol 2006;206:586–93.[CrossRef][Medline]
  10. Brown RA, Domin J, Arcaro A, Waterfield MD, Shepherd PR. Insulin activates the {alpha} isoform of class II phosphoinositide 3-kinase. J Biol Chem 1999;274:14529–32.[Abstract/Free Full Text]
  11. Arcaro A, Zvelebil MJ, Wallasch C, Ullrich A, Waterfield MD, Domin J. class II phosphoinositide 3-kinases are downstream targets of activated polypeptide growth factor receptors. Mol Cell Biol 2000;20:3817–30.[Abstract/Free Full Text]
  12. Turner SJ, Domin J, Waterfield MD, Ward SG, Westwick J. The CC chemokine monocyte chemotactic peptide-1 activates both the class I p85/p110 phosphatidylinositol 3-kinase and the class II PI3K-C2{alpha}. J Biol Chem 1998;273:25987–95.[Abstract/Free Full Text]
  13. Ktori C, Shepherd PR, O'Rourke L. TNF-{alpha} and leptin activate the {alpha}-isoform of class II phosphoinositide 3-kinase. Biochem Biophys Res Commun 2003;306:139–43.[CrossRef][Medline]
  14. Maffucci T, Cooke FT, Foster FM, Traer CJ, Fry MJ, Falasca M. Class II phosphoinositide 3-kinase defines a novel signaling pathway in cell migration. J Cell Biol 2005;169:789–99.[Abstract/Free Full Text]
  15. Katso R, Okkenhaug K, Ahmadi K, White S, Timms J, Waterfield MD. Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu Rev Cell Dev Biol 2001;17:615–75.[CrossRef][Medline]
  16. Domin J, Harper L, Aubyn D, et al. The class II phosphoinositide 3-kinase PI3K-C2β regulates cell migration by a PtdIns3P dependent mechanism. J Cell Physiol 2005;205:452–62.[CrossRef][Medline]
  17. Katso RM, Pardo OE, Palamidessi A, et al. Phosphoinositide 3-kinase c2β regulates cytoskeletal organization and cell migration via rac-dependent mechanisms. Mol Biol Cell 2006;17:3729–44.[Abstract/Free Full Text]
  18. Wang Y, Yoshioka K, Azam MA, et al. Class II phosphoinositide 3-kinase {alpha}-isoform regulates Rho, myosin phosphatase and contraction in vascular smooth muscle. Biochem J 2006;394:581–92.[CrossRef][Medline]
  19. Didichenko SA, Fragoso CM, Thelen M. Mitotic and stress-induced phosphorylation of HsPI3K-C2{alpha} targets the protein for degradation. J Biol Chem 2003;278:26055–64.[Abstract/Free Full Text]
  20. Arcaro A, Khanzada UK, Vanhaesebroeck B, Tetley TD, Waterfield MD, Seckl MJ. Two distinct phosphoinositide 3-kinases mediate polypeptide growth factor-stimulated PKB activation. EMBO J 2002;21:5097–108.[CrossRef][Medline]
  21. Kang S, Song J, Kang J, et al. Suppression of the {alpha}-isoform of class II phosphoinositide 3-kinase gene expression leads to apoptotic cell death. Biochem Biophys Res Commun 2005;329:6–10.[Medline]
  22. Ho LK, Liu D, Rozycka M, Brown RA, Fry MJ. Identification of four novel human phosphoinositide 3-kinases defines a multi-isoform subfamily. Biochem Biophys Res Commun 1997;235:130–7.[CrossRef][Medline]
  23. Samuels Y, Velculescu VE. Oncogenic mutations of PIK3CA in human cancers. Cell Cycle 2004;3:1221–4.[Medline]
  24. Wymann MP, Zvelebil M, Laffargue M. Phosphoinositide 3-kinase signalling-which way to target? Trends Pharmacol Sci 2003;24:366–76.[CrossRef][Medline]
  25. Misawa H, Ohtsubo M, Copeland NG, Gilbert DJ, Jenkins NA, Yoshimura A. Cloning and characterization of a novel class II phosphoinositide 3-kinase containing C2 domain. Biochem Biophys Res Commun 1998;244:531–9.[CrossRef][Medline]
  26. Ono F, Nakagawa T, Saito S, et al. A novel class II phosphoinositide 3-kinase predominantly expressed in the liver and its enhanced expression during liver regeneration. J Biol Chem 1998;273:7731–6.[Abstract/Free Full Text]
  27. Rozycka M, Lu YJ, Brown RA, Lau MR, Shipley JM, Fry MJ. cDNA cloning of a third human C2-domain-containing class II phosphoinositide 3-kinase, PI3K-C2{gamma}, and chromosomal assignment of this gene (PIK3C2G) to 12p12. Genomics 1998;54:569–74.[CrossRef][Medline]
  28. MacKeigan JP, Murphy LO, Blenis J. Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat Cell Biol 2005;7:591–600.[CrossRef][Medline]
  29. Cho SG, Choi EJ. Apoptotic signaling pathways: caspases and stress-activated protein kinases. J Biochem Mol Biol 2002;35:24–7.[Medline]
  30. Tuschl T. Functional genomics: RNA sets the standard. Nature 2003;421:220–1.[CrossRef][Medline]
  31. Knight ZA, Gonzalez B, Feldman ME, et al. A pharmacological map of the PI3-K family defines a role for p110{alpha} in insulin signaling. Cell 2006;125:733–47.[CrossRef][Medline]
  32. Arcaro A, Volinia S, Zvelebil MJ, et al. Human phosphoinositide 3-kinase C2β, the role of calcium and the C2 domain in enzyme activity. J Biol Chem 1998;273:33082–90.[Abstract/Free Full Text]
  33. Domin J, Pages F, Volinia S, et al. Cloning of a human phosphoinositide 3-kinase with a C2 domain that displays reduced sensitivity to the inhibitor wortmannin. Biochem J 1997;326:139–47.[Medline]
  34. Moffat J, Grueneberg DA, Yang X, et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 2006;124:1283–98.[CrossRef][Medline]
  35. Gaidarov I, Smith ME, Domin J, Keen JH. The class II phosphoinositide 3-kinase C2{alpha} is activated by clathrin and regulates clathrin-mediated membrane trafficking. Mol Cell 2001;7:443–9.[CrossRef][Medline]
  36. Huesken D, Lange J, Mickanin C, et al. Design of a genome-wide siRNA library using an artificial neural network. Nat Biotechnol 2005;23:995–1001.[CrossRef][Medline]
  37. Stewart SA, Dykxhoorn DM, Palliser D, et al. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 2003;9:493–501.[Abstract/Free Full Text]
  38. Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996;272:263–7.[Abstract]
  39. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 1997;15:871–5.[CrossRef][Medline]
  40. Yee JK, Friedmann T, Burns JC. Generation of high-titer pseudotyped retroviral vectors with very broad host range. Methods Cell Biol 1994;43 Pt A:99–112.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Google Scholar
Right arrow Articles by Elis, W.
Right arrow Articles by MacKeigan, J. P.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elis, W.
Right arrow Articles by MacKeigan, J. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation