
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Surgery, Duke University Medical Center, Durham, North Carolina
Requests for reprints: Jeffrey R. Marks, Department of Surgery, Duke University Medical Center, Box 3873, Durham, NC 27710. Phone: 919-681-6133; Fax: 919-681-6291. E-mail: marks003{at}mc.duke.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Supporting evidence for the role of TAFII31 and TAFII70 as p53 coactivators include the following
Whereas these in vitro studies suggest that TAFII31 and TAFII70 function as p53 coactivators, little is known about the specific intracellular functions of these TAFs.
TAFII70 is one of four TAFs to participate in a histone-like structure contacting the other members of this complex through a histone fold motif similar to the one found in histone H4 (7). TAFII70 is alternatively spliced, producing four slightly different protein products. Among these is a recently described variant that lacks 10 amino acids disrupting the second helix of the histone fold domain (8). This variant was shown to be induced on apoptotic stimuli and could participate in this pathway via an altered interaction with TAFII31.
Here, we report the biological activity of the two most common isoforms of TAFII70 in breast epithelial cells. One of these forms, more highly expressed in normal breast, causes growth suppression due to a G2 arrest, whereas the other common splice variant does not have this property and is more highly expressed in breast cancer. Further, we present evidence of a novel protein interaction of the growth suppressing isoform of TAFII70 with the G2 arrest gene, GADD45a.
| Results |
|---|
|
|
|---|
isoform with a predicted Mr of 72 kDa splices an upstream alternative exon in the middle of the first coding exon (exon 2). The ß isoform has an intact exon 2 that contains an upstream start codon introducing an additional 50 amino acids to the NH2 terminus of the protein. A third upstream splice variant removes additional sequence within exon 2 but codes for the same protein as the
isoform (we have termed this TAFII70
-AS). Finally, two other variants result from alternative splice site utilization within coding exons 2 and 13. Each of these splice variants (
and
) results in the loss of 10 amino acids (the final 30 bp of the aforementioned exons). By semiquantitative reverse transcription-PCR (RT-PCR) from breast epithelial cells, both normal and cancer derived, we found that the most abundant isoforms are TAFII70
, TAFII70
-AS, and TAFII70ß. Very low or undetectable levels of the
and
variants were found under normal growth conditions. Because TAFII70
-AS and TAFII70
code for the same protein, we concentrated our efforts on the
and ß coding variants. The ß form codes for a protein with a predicted Mr of 78 kDa and has been termed TAFII80 (8). For clarity, we call the smaller
isoform TAFII70 and the larger ß form TAFII80.
|
|
|
|
From a subset of these samples, we also examined isoform expression at the protein level. The position of the two protein species (resolved on gradient SDS-PAGE) is indicated by extracts from cells transfected with either TAFII70 (Fig. 4C, lane 10) or TAFII80 (Fig. 4C, lane 11). In primary breast cancers, the ratio of the splice variants is skewed toward the larger TAFII80 isoform, whereas the normal breast specimens all have a higher level of TAFII70. These results mirror the transcript levels of the different isoforms in cancer and normal breast epithelia.
Transcriptional Activation by TAFII70 Isoforms
The putative function of the TAFs is to participate in transcription in the context of the general transcription factor, TFIID. Whereas these factors may influence the transcription of a broad set of genes, there is also evidence that some genes may be specifically affected (9, 10). Isoform-specific transcriptional activity could serve to explain the observed disparity in growth suppression. To test this hypothesis, the normal breast epithelial line, MCF10A, was transiently transfected with TAFII70, TAFII80, or the parental pcDNA vector, and total RNA was used to prepare probe for hybridization to Affymetrix gene chip arrays (U95,
12,000 probe sets). Duplicate cultures were transfected with each vector and hybridized to separate chips. Results from these experiment showed a remarkable absence of a dramatic transcriptional effect by either TAFII70 or TAFII80 compared with the pcDNA control transfection. Genes with >2-fold change in expression from both independent experiments are listed in Table 1. Using this criterion, we separated these genes into four classes: (a) genes induced by both TAFII70 and TAFII80, (b) genes induced by TAFII70 alone, (c) genes repressed by both TAFII70 and TAFII80, and (d) genes repressed by TAFII70 alone. None of the genes that are specifically affected by TAFII70 have an obvious link to growth arrest. One gene linked to G2 arrest that did come out of this screen is GADD45a; however, it was induced equally by both TAFII70 isoforms. Bell et al. (8) also showed increased levels of GADD45a transcript after introduction of TAFII70. Overexpression of GADD45a in breast epithelial cells results in growth suppression, G2 arrest, and reduced colony formation analogous to TAFII70 (11).
|
|
In vitro transcribed and translated with [35S]methionine, GADD45a and TAFII70/TAFII80 proteins were synthesized and subjected to immunoprecipitation (Fig. 6A). Nearly equal levels of TAFII70 and TAFII80 were synthesized in these reactions (lanes 1 and 2); however, when pulled down with an antibody to GADD45a, TAFII70, but not TAFII80, was coprecipitated (lanes 3 to 6). Next, to determine whether this interaction could be detected in cells, we constructed a vector expressing full-length GADD45a with the V5 epitope in frame at the COOH terminus. This construct was cotransfected with TAFII70, TAFII80, or pcDNA into MCF10A cells, and protein extracts were prepared. These extracts were immunoprecipitated with monoclonal antibodies to either TAFII70/TAFII80 or the V5 epitope. After transfer, the blots were cut and probed with antibodies to these proteins (Fig. 6B). Using the V5 antibody for immunoprecipitation, the TAFII70 protein was clearly detected by immunoblotting (lanes 1 to 3). Little or no TAFII80 could be seen in this immunoprecipitation. The same extracts subjected to immunoprecipitation with anti-TAFII70/TAFII80 antibody revealed high levels of both TAFs (lanes 4 to 6). Detecting with an antibody to GADD45a showed that this protein is clearly present in an immunoprecipitated complex when TAFII70, but not TAFII80, is expressed.
|
, ß, and
) and were changed to code for strings of alanines. The three mutations in this series (M62-67, M74-79, and M82-87) all coprecipitated with TAFII70; however, M62-67 exhibited the weakest complex. Again, of note is that the M62-67 mutation failed to induce a G2 arrest or form a detectable complex with CDC2. Therefore, the domain responsible for interaction of GADD45 with TAFII70 seems to fully overlap with that shown previously to complex with CDC2 and lead to G2 arrest. Whereas TAFII70 dramatically suppressed colony formation (Fig. 2), some of the colonies that did form continued to grow and overexpress the 70-kDa isoform. Individual G418-resistant MCF7 colonies from TAFII70, TAFII80, and pcDNA transfections were cloned and analyzed for transgene expression and growth characteristics. Clones with comparable growth rates were expanded and analyzed to determine whether the interaction between TAFII70 and GADD45a was maintained concomitant with TAFII70 overexpression (Fig. 6E). Coimmunoprecipitation/immunoblotting revealed that whereas TAFII70 protein levels were maintained at high levels after 2 months in continuous culture, the interaction with GADD45a could no longer be detected. This result suggests that the association between GADD45a and TAFII70 has direct or indirect functional significance with respect to growth inhibition.
GADD45a Null Cells Are Not Susceptible to TAFII70 Inhibition
To directly test whether GADD45a was required for TAFII70 growth suppression, we did colony formation assays on mouse embryo fibroblasts derived from GADD45a knockout mice (15). Two independent pairs of lines were used in these assays, one pair that underwent spontaneous immortalization and another pair that was immortalized by introduction of human papilloma virus E7 and activated H-ras (designated "ER"). Mouse embryo fibroblast cell lines from GADD45 / and wild-type (+/+) littermates were transfected with pcDNA, TAFII70, or TAFII80 and selected with hygromycin. TAFII70 significantly inhibited colony formation of both wild-type lines but did not diminish the selective growth of either of the GADD45 null cell lines (Fig. 7). In contrast, GADD45 status was not a factor in TAFII80-related colony formation. Both wild-type and null cells showed only slight inhibition when transfected with TAFII80 compared with the pcDNA control transfections. These results indicate that TAFII70 exerts growth suppression through GADD45a, either directly or indirectly, whereas the activity of TAFII80 in this regard does not depend on the presence of GADD45.
|
| Discussion |
|---|
|
|
|---|
Of the five alternatively spliced forms of TAFII70 that have thus far been described, we found that three of these predominate in breast epithelial cells. Two of these splice variants code for different proteins, TAFII80 (726 amino acids) and TAFII70 (677 amino acids lacking the NH2-terminal 49 amino acids of TAFII80). In our initial characterization of these two isoforms, we found that overexpression of TAFII70, but not TAFII80, caused a dramatic growth suppression of breast epithelial cells, both normal and cancer derived, expressing wild-type or mutant p53. This growth suppression is attributable to an arrest in the G2 phase of the cell cycle preventing entry into mitosis. The only cell line that was equally affected by both TAFII70 and TAFII80 expression was HCC1937, a breast cancer line harboring hemizygous BRCA1 and p53 mutations. From these data, we concluded that TAFII70 was likely not acting through specific enhancement of p53 transcriptional activity. This was further supported by a series of transient expression assays on p53 responsive promoters that showed no stimulation of p53-mediated transcription by TAFII70 or TAFII80 in breast epithelial cell lines (11).
Because there was a dramatic biological difference between the two major protein isoforms, we examined their expression in a series of breast cells and primary breast tissues. By quantitative RT-PCR, we found that the ratio between the isoforms was skewed toward TAFII70 in normal breast epithelium and toward TAFII80 in breast carcinomas. There was
7-fold difference in the median ratio between cancer and normal. This differential expression translated into differences in protein accumulation as well. Varying mixtures of the two isoforms may affect the assembly and function of TFIID and other TAF-containing complexes. Evidence from yeast TFIID suggests that there are four core TAFs that form an octamer complex (two copies of each). Three of these TAFs contain a histone fold domain (including the yeast homologue of TAFII70, yTAF60). Disruption of the histone fold disrupts the octamer, and overexpression of a wild-type TAF can overcome the effects of a temperature-sensitive mutation in the histone fold domain (7).
In searching for the basis of the specific G2 arrest induced by TAFII70, we examined downstream genes that might be affected. GADD45a, well known to participate in G2 arrest, was induced at the mRNA level by transient expression of TAFII70. Overexpression of GADD45a could explain the observed phenotype; however, it was induced to an equal degree by TAFII80. Bell et al. (8) have also shown that the
isoform of TAFII70 (lacking 10 amino acids in the histone fold motif) induces GADD45a expression. As opposed to the G2 arrest that we have observed in breast cells, expression of either TAFII70 or the
isoform in HeLa cells resulted in an apoptotic response. Consistent with the disruption of the histone fold motif in the
isoform, Bell et al. suggested that an altered association with another histone fold containing TAF (TAFII31) could mediate the apoptotic activity of this isoform. By RT-PCR, we have detected expression of the
isoform in breast cells; however, it is in relatively low abundance compared with TAFII70
and TAFII70ß. Nonetheless, their study does provide precedent for isoform-specific action of this TAF.
In further pursuing the differential action of TAFII70 and TAFII80, we did a global transcriptional analysis using expression arrays. The most surprising aspect of this experiment was the relatively small impact that overexpression of either of these transcriptional accessory factors had on steady-state transcript levels. The short list of genes consistently affected by overexpression of either isoform includes GADD45a. Genes induced at least 2-fold by TAFII70 alone include S100A3, UNC13, NDUFS6, the vitamin D receptor, STAT1, PCTAIRE2BP, and OAS1. Of these genes, the vitamin D receptor can mediate cell cycle effects combined with pharmacologic doses of vitamin D or its analogues (26, 27). STAT1 may have a positive or negative influence on cell growth; however, these effects stem largely from phosphorylation followed by nuclear translocation of the protein (28). From these data, there was not a compelling case to be made that a specific transcriptional activation event was the root cause of TAFII70 growth suppression.
Because GADD45a was the most obvious common gene implicated in the G2 arrest phenomenon, we focused on possible interactions with this protein. This became a logical investigation for several reasons:
Through its interaction and inhibition of the CDC2 kinase, GADD45a is believed to mediate its G2 checkpoint effect (33, 34). Therefore, if both TAF isoforms induce GADD45 but only one is able to bind the protein, perhaps via its interaction with the histone fold motif, this could serve to explain the observed phenomenon.
Our findings in this regard were somewhat surprising and counter to our expectations. We found that TAFII70, but not TAFII80, formed a protein complex with GADD45a. This interaction was specific whether we captured TAFII70 first or GADD45a. Using a series of deletion mutations in GADD45a, the interaction domain was mapped to amino acids 50 to 76. This is the same region of the protein that is also required for binding to CDC2 and inducing G2 arrest (14). In addition, colocalization studies indicated that TAFII70, but not TAFII80, shares the same subcellular distribution with GADD45a (data not shown). Further, cell lines that managed to overcome TAFII70-mediated growth inhibition do not contain demonstrable TAFII70-GADD45 complexes. Finally, TAFII70-specific growth inhibition was completely abrogated in GADD45a null cells.
The functional significance of this complex is not known; however, a study by Carrier et al. (13) provides possible insight. Their work showed that GADD45a directly associates with core histones and can facilitate topoisomerase relaxation and cleavage activity on nucleosomes. The interaction is increased by histone acetylation or UV irradiation. The implication from this work is that GADD45a recognizes altered chromatin and perhaps recruits repair complexes to these sites. In addition to inactivation of CDC2 kinase, this may be another mechanism through which GADD45a promotes cell cycle arrest. TAFII70 is one of the four TAFs to form a histone fold octamer (7). This octamer is similar in several respects to the analogous structure formed by the core histones. Therefore, the recruitment of GADD45a to this structure should not be entirely unexpected. All indications are that this TAF structure is associated with chromatin; therefore, nucleating GADD45a to this structure may have the same consequences as when it contacts nucleosomes. The relative level of the two isoforms in cancer versus normal breast may be functionally significant, particularly in the component of DNA damage response that is mediated by GADD45a. Cancers have a higher relative level of the TAFII80 isoform that fails to complex with GADD45. This could serve to blunt the growth arrest and/or DNA repair process.
One other interesting aspect of this work relates to the single cell line that showed equivalent growth suppression with both TAFII70 and TAFII80 expression. The HCC1937 breast cancer cell line contains a hemizygous inactivating frameshift mutation in the BRCA1 gene (5283insC). There is now a firm link between BRCA1 and the G2 checkpoint (35, 36), and one of the primary genes induced on BRCA1 expression is GADD45a (1, 37, 38). This suggests that GADD45a is involved in BRCA1-mediated G2 arrest (39). Unlike most other breast cancer cell lines and tissues, HCC1937 cells have high basal levels of GADD45a mRNA (11), suggesting that there is a negative feedback loop with BRCA1. A significant body of evidence implicates the involvement of BRCA1 with normal and damaged chromatin (40-43). Because we must postulate that differences in conformation or protein-protein interactions lead to the difference in GADD45a binding, equivalent growth suppression by the two TAFII70 isoforms in HCC1937 cells raises the possibility that BRCA1 may influence the binding or conformation of GADD45a or the histone-like TAFs.
| Materials and Methods |
|---|
|
|
|---|
Mouse embryo fibroblast cell lines derived from GADD45 null mice and control littermates (provided by M.C. Hollander, National Cancer Institute, Bethesda, MD) were grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (15). Two pairs of these cell line were used: (a) spontaneously immortalized GADD45 +/+ and / fibroblasts and (b) fibroblasts immortalized via expression of human papilloma virus E7 plus H-ras V12 (+/+ ER and / ER).
Tissue Specimens
Tissues were obtained from Duke University Medical Center (Durham, NC) only after it was determined that there was sufficient material for diagnosis under a Duke institutional review boardapproved protocol. These specimens were flash frozen and maintained in the Duke Breast Cancer SPORE Tissue Bank at 135°C with associated clinical and pathologic data kept in a password-protected database. Before extraction, all specimens were sectioned and stained with H&E to evaluate the percentage of cancer and normal epithelia. Only tissues that were predominantly of the appropriate cell type were used for this study. Total RNA and protein were extracted from these specimens as described previously (46). For laser capture microdissection, tissues were sectioned at 5 µm, dehydrated, and stained with hematoxylin (47). A PixCell II (Arcturus, Mountain View, CA) microscope was used to obtain pure populations of epithelial cells from normal and neoplastic frozen specimens. RNA was extracted using the Stratagene Micro RNA Isolation Kit (La Jolla, CA) according to the manufacturer's recommendations.
Plasmids
Human TAFII70 was subcloned from the expression vector pET-TAFII70 (provided by R. Tjian, Berkeley University, Berkeley, CA) into pcDNA3.1. The sequence of this plasmid was confirmed by resequencing and was verified to code for the 677amino acid (predicted Mr 72.7 kDa) form termed TAFII70
(48). TAFII80 (TAFII70ß, 726 amino acids, predicted Mr 77.9 kDa) was cloned from a PCR product into the same vector and sequence verified. The GADD45a cDNA was amplified by PCR and cloned in-frame into the pcDNA-DEST40 vector with a COOH-terminal V5 tag. The pcDNA3-GADD45-HA and deletion/mutation constructs thereof were kindly provided by Dr. Xinwei Wang (NIH, Bethesda, MD; ref. 13).
Colony Growth Inhibition Assays
Cells were transfected with 5 µg of the neomycin-resistant expression vector pcDNA3.1, pcDNA3.1-TAFII70, or pcDNA3.1-TAFII80. 26NC cells were seeded at 2.5 x 105 per 60 mm dish, and all other cells were seeded at 5 x 105 per 60 mm dish 1 day prior to transfection. Cells were washed in reduced serum medium (Opti-MEM I, Life Technologies) and transfected using the Superfect transfection reagent (Qiagen, Valencia, CA). Cells were incubated with the Superfect reagent for 3 hours, at which time the medium was aspirated and replaced. Selection of viable transfected cells was initiated 48 hours later with geneticin/G418 sulfate (Life Technologies). Cells were maintained in culture in their respective medium containing 10% fetal bovine serum plus 600 µg/mL G418 (or 100 µg/mL G418 for 26NC cells) for
3 weeks. G418-resistant cells were stained with a modified Giemsa stain (Sigma Chemical Co., St. Louis, MO), and colonies
100 µm in diameter were counted by visual examination.
On parallel plates of MCF7 cells transfected with TAFII70, TAFII80, and pcDNA, G418-resistant colonies were isolated using cloning cylinders. These clones were propagated individually and tested for continued elevated expression of the exogenous transgene by immunoblotting. Clones that continued to express high levels of TAFII70 and TAFII80 were expanded and stored.
Immortalized mouse embryo fibroblasts were cotransfected with pTK-Hyg (Clontech, Palo Alto, CA), and either pcDNA, TAFII70, or TAFII80 using Lipofectin (Invitrogen, Carlsbad, CA) was selected for 2 weeks in the presence of 100 µg/mL hygromycin (Sigma Chemical). Colonies were stained and scored as described above.
Cell Cycle Analysis
To examine cell cycle effects mediated by TAFII70, cells were seeded in 60 mm dishes at 3 x 105 cells per dish and transfected with 5 µg of pcDNA or the pcDNA-TAFII70 construct and 1 µg of pEGFP-NI (Clontech; expressing GFP) using GenePorter (Gene Therapy Systems, San Diego, CA). After 24 hours, cells were stained for DNA content with propidium iodide. Briefly, cells were trypsinized and fixed in 2% paraformaldehyde for 30 minutes at room temperature. After washing with PBS, cells were permeabilized with 70% ethanol (in PBS) at 4°C for 30 minutes. Cells were washed in PBS and resuspended in 0.5 mL of PBS containing 100 µg/mL RNase A and 50 µg/mL propidium iodide (Life Technologies), and DNA content was quantitated by flow cytometry.
Mitotic Index Assays
Cells were seeded at 1 x 104 in chamber slides and transfected with pcDNA or TAFII70 using GenePorter. On the next day, the medium was replaced with fresh medium containing 0.4 µg/mL nocodazole (Sigma Chemical). After 24 hours, cells were fixed with 3% paraformaldehyde for 30 minutes at room temperature. After washing in PBS, cells were stained with a propidium iodide solution containing 500 µg/mL RNase A and 50 µg/mL propidium iodide (Life Technologies) and incubated at 4°C for 30 minutes. For each sample, 500 cells were randomly counted by fluorescent microscopy. Mitotic cells were scored based on their lack of nuclear membrane and evidence of chromosome condensation. All assays were done in triplicate.
Transcriptional Activation by TAFII70 and Northern Blotting
TAFII70, TAFII80, or pcDNA were cotransfected with an enhanced GFP expression vector (pIRES2-EGFP, Clontech). After 24 hours, transfected cells were physically sorted by flow cytometry based on the GFP signal. Total RNA was isolated from the GFP-positive cells using Qiagen RNeasy kits. For Northern blots, RNA (5 µg) was electrophoresed on a 1% agarose-formaldehyde gel and transferred onto a nylon membrane (ICN Pharmaceuticals, Inc., Costa Mesa, CA). Hybridizations were done as described previously (49).
Quantitative RT-PCR
Real-time PCR for TAFII70- or TAFII80-specific sequences was done using the LightCycler system (Roche Diagnostics, Indianapolis, IN) according to the manufacturer's instructions. The primers were TAF80QT1F (TTCTTTTTCTTCTGCCTGCCC), TAF80QT1R (ACTTCAAGGCATCCTGTGCG), TAF70QT1F (ACGGTTGGTTGTGTGTCTGTGCTC), and TAF70QT1R (TTCCCTGGCGAACTCCTACGAATC). A standard reaction mixture contained 2 µL Titanium PCR buffer (Clontech), 1 µL 100x bovine serum albumin (New England Biolab, Beverly, MA), 1x SYBR Green I (Molecular Probes, Eugene, OR), 0.5 mmol/L deoxynucleotide triphosphates, 0.25 µmol/L forward and reverse primers, 1x AdvanTaqPlus polymerase (Clontech), and 5 ng cDNA. A typical cycling profile included a hot start at 95°C for 120 seconds followed by 40 cycles of a denaturation step at 95°C denaturation for 0 second, 58°C annealing for 10 seconds, 72°C of extension for 12 seconds, and a fluorescent signal detection at the melting temperature of 88°C. The standard curve was generated from a serial dilution of TAFII70 or TAFII80 plasmid.
Gene Chip Expression Analysis
MCF10A cells were transfected with TAFII70, TAFII80, or pcDNA using GenePorter. Total RNA was extracted 18 hours after transfection. Parallel transfections were done for protein extraction to verify that the transfection produced high levels of the desired protein. The human U95 array (Affymetrix, Santa Clara, CA) was hybridized with a cRNA probe as described previously (46). The experiment was repeated with RNA derived from a different transfection several weeks later. Data were analyzed using Affymetrix software to rank order genes that were induced or repressed compared with the pcDNA control transfection.
Immunoblotting and Immunoprecipitation
Whole cell protein lysates were obtained from log-growing cells using 1% NP40 lysis buffer [150 mmol/L NaCl, 50 mmol/L Tris (pH 8), and 1% NP40] supplemented with protease inhibitors. Cells were lysed for 30 minutes at 4°C, and protein concentrations were quantitated using the Bradford assay. Protein (100 µg) was separated by SDS-PAGE and electrotransferred onto nitrocellulose. After blocking in 5% dried milk and PBS-T, TAFII70/TAFII80 was detected using a mouse monoclonal antibody at a 1:200 dilution (Transduction Laboratories, Newington, NH). Chemiluminescence (NEN, Wilmington, DE) was done after incubating blots in an antimouse secondary antibody conjugated to horseradish peroxidase (1:5,000 dilution, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Monoclonal antibodies against the V5 (Invitrogen, 1:5,000) or HA epitope tags (Roche Diagnostics, 1:500) were used to detect GADD45 fusion proteins. Immunoprecipitations were carried out by incubating 2 mg of protein with primary antibodies and protein A/G agarose beads at 4°C for 4 hours. The precipitating material was washed three times, boiled, and subjected to immunoblotting as described above.
| Notes |
|---|
|
|
|---|
Note: W. Wang and R. Nahta contributed equally to this work. R. Nahta is currently at Breast Medical Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX. ![]()
Received May 18, 2004; revised June 21, 2004; accepted June 22, 2004.
| References |
|---|
|
|
|---|
links apoptotic signaling pathways to transcription factor TFIID function. Mol Cell 2001;8:591600.[CrossRef][Medline]
,25-dihydroxyvitamin D-3 in human prostate cancer cell line LNCaP involves reduction of cyclin-dependent kinase 2 activity and persistent G1 accumulation. Endocrinology 1998;139:1197207.This article has been cited by other articles:
![]() |
J. A. Calarco, Y. Xing, M. Caceres, J. P. Calarco, X. Xiao, Q. Pan, C. Lee, T. M. Preuss, and B. J. Blencowe Global analysis of alternative splicing differences between humans and chimpanzees Genes & Dev., November 15, 2007; 21(22): 2963 - 2975. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Chang, D. Bhatia, Y. Zhang, T. Meighan, V. Castranova, X. Shi, and F. Chen Incorporation of an Internal Ribosome Entry Site-Dependent Mechanism in Arsenic-Induced GADD45{alpha} Expression Cancer Res., July 1, 2007; 67(13): 6146 - 6154. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, D. Bhatia, H. Xia, V. Castranova, X. Shi, and F. Chen Nucleolin links to arsenic-induced stabilization of GADD45{alpha} mRNA Nucleic Acids Res., January 18, 2006; 34(2): 485 - 495. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||