Molecular Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Chemical and Biological Aspects of Inflammation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, W.
Right arrow Articles by Marks, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, W.
Right arrow Articles by Marks, J. R.
Molecular Cancer Research 2:442-452 (2004)
© 2004 American Association for Cancer Research

Cell Cycle, Cell Death, and Senescence

TAFII70 Isoform-Specific Growth Suppression Correlates With Its Ability to Complex With the GADD45a Protein1

Wei Wang, Rita Nahta, Gudrun Huper and Jeffrey R. Marks

Department of Surgery, Duke University Medical Center, Durham, North Carolina

Requests for reprints: Jeffrey R. Marks, Department of Surgery, Duke University Medical Center, Box 3873, Durham, NC 27710. Phone: 919-681-6133; Fax: 919-681-6291. E-mail: marks003{at}mc.duke.edu


   Abstract
Top
 Notes
 Abstract
Introduction
 Results
 Discussion
 Materials and Methods
 References
 
TAFII70, a member of the basal transcription complex implicated in p53-mediated transcription, is synthesized as several alternately spliced variants. The predominant forms found in normal and neoplastic breast epithelial cells are shown to be 72 kDa (TAFII70) and 78 kDa (TAFII80). Most cancers express higher levels of the TAFII80 isoform, whereas normal breast epithelia express higher levels of the TAFII70 isoform. Expression of TAFII70, but not TAFII80, causes dramatic growth suppression of normal and transformed breast epithelial cell lines in a p53-independent manner. Growth suppression correlates with mitotic inhibition resulting from an increased number of cells in G2. Both isoforms induce expression of the G2 arrest associated gene, GADD45a, but a novel protein-protein interaction was observed between TAFII70 (not TAFII80) and GADD45a, suggesting that this interaction is important for the observed growth arrest phenotype induced by the TAFII70 isoform. GADD45a null cells are not subject to TAFII70 inhibition, further supporting the relevance of this interaction.


   Introduction
Top
 Notes
 Abstract
 Introduction
Results
 Discussion
 Materials and Methods
 References
 
The p53 tumor suppressor protein is an important mediator of the cellular response to DNA damage. P53 induces expression of several cell cycle regulatory genes that function at the G1-S and G2-M cell cycle checkpoints. In vitro studies suggest that transcriptional activation properties of p53 may be potentiated through interactions with components of the basal transcription machinery. The NH2-terminal p53 activation domain interacts directly with the TATA binding protein and the TATA binding protein–associated factors (TAF) TAFII31 (TAF9) and TAFII70 (TAF6; refs. 1-4), all three of which are subunits of the general transcription factor, transcription factor IID (TFIID). TATA binding protein is an essential core component of the basal transcription apparatus that can interact with p53 to synergistically activate transcription in vitro (5, 6).

Supporting evidence for the role of TAFII31 and TAFII70 as p53 coactivators include the following

  1. Missense mutations in the activation domain of p53 that disrupt its interactions with TAFII31 and TAFII70 also impair p53-mediated transactivation (3, 4).
  2. Antibodies against TAFII31 block p53-stimulated transcription but do not diminish basal transcription levels (3, 6).
  3. Partial recombinant TFIID complexes containing the Drosophila homologues of TATA binding protein, TAFII31, and TAFII70 support p53-mediated transcription, whereas a complex lacking TAFII31 and TAFII70 supports only basal levels of transcription in the presence of p53 (4).

Whereas these in vitro studies suggest that TAFII31 and TAFII70 function as p53 coactivators, little is known about the specific intracellular functions of these TAFs.

TAFII70 is one of four TAFs to participate in a histone-like structure contacting the other members of this complex through a histone fold motif similar to the one found in histone H4 (7). TAFII70 is alternatively spliced, producing four slightly different protein products. Among these is a recently described variant that lacks 10 amino acids disrupting the second helix of the histone fold domain (8). This variant was shown to be induced on apoptotic stimuli and could participate in this pathway via an altered interaction with TAFII31.

Here, we report the biological activity of the two most common isoforms of TAFII70 in breast epithelial cells. One of these forms, more highly expressed in normal breast, causes growth suppression due to a G2 arrest, whereas the other common splice variant does not have this property and is more highly expressed in breast cancer. Further, we present evidence of a novel protein interaction of the growth suppressing isoform of TAFII70 with the G2 arrest gene, GADD45a.


   Results
Top
 Notes
 Abstract
 Introduction
 Results
Discussion
 Materials and Methods
 References
 
Growth Suppression by TAFII70
The rationale for our investigation of TAFII70 began with its putative role in p53-mediated transactivation. There are several isoforms of TAFII70 that arise from alternative splicing and utilization of cryptic splice sites within exons (Fig. 1). The {alpha} isoform with a predicted Mr of 72 kDa splices an upstream alternative exon in the middle of the first coding exon (exon 2). The ß isoform has an intact exon 2 that contains an upstream start codon introducing an additional 50 amino acids to the NH2 terminus of the protein. A third upstream splice variant removes additional sequence within exon 2 but codes for the same protein as the {alpha} isoform (we have termed this TAFII70{alpha}-AS). Finally, two other variants result from alternative splice site utilization within coding exons 2 and 13. Each of these splice variants ({gamma} and {delta}) results in the loss of 10 amino acids (the final 30 bp of the aforementioned exons). By semiquantitative reverse transcription-PCR (RT-PCR) from breast epithelial cells, both normal and cancer derived, we found that the most abundant isoforms are TAFII70{alpha}, TAFII70{alpha}-AS, and TAFII70ß. Very low or undetectable levels of the {gamma} and {delta} variants were found under normal growth conditions. Because TAFII70{alpha}-AS and TAFII70{alpha} code for the same protein, we concentrated our efforts on the {alpha} and ß coding variants. The ß form codes for a protein with a predicted Mr of 78 kDa and has been termed TAFII80 (8). For clarity, we call the smaller {alpha} isoform TAFII70 and the larger ß form TAFII80.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 1. The known splice variants of TAFII70 (TAF6, Unigene ID Hs.78865). The nomenclature for these variants is derived from the original cloning and sequencing of the human gene (48). TAFII70ß uses the upstream ATG and is referred to in this article and other work (8) as TAFII80. TAFII70{alpha}-AS codes for the same protein as TAFII70{alpha}. The {gamma} and {delta} variants seem to be the result of cryptic splice site utilization ({Delta}) in exons 13 and 2, respectively.

 
We cloned and sequenced verified TAFII70 and TAFII80 cDNAs in the mammalian expression vector, pcDNA3.1. In attempting to produce stable cell lines expressing these two forms, we observed a significant and reproducible inhibition of colony formation with the TAFII70 cDNA but very little growth inhibition with TAFII80 (Fig. 2A). These assays were repeated and quantitated in several cell lines, both normal and cancer derived (Fig. 2B). In all cells, except for the BRCA1 mutated HCC1937 line, TAFII70 effectively suppressed colony formation, whereas TAFII80 had only modest effects. In the HCC1937 cells, both isoforms induced an equivalent level of suppression. Both p53 wild-type (MCF10A, DU99, 26NC, and MCF7) and p53 mutant (T47D, SKBR3, and BT474) cell lines showed dramatic growth suppression with TAFII70. Cotransfecting equal amounts of TAFII70 and TAFII80 resulted in an intermediate number of colonies, suggesting that neither isoform is entirely dominant in its action. In transient transfections using these two vectors, exogenously expressed protein was of the correct size, and steady-state levels were nearly the same, verifying the integrity of the plasmid constructs (Fig. 2C).



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 2. TAFII70 inhibits colony survival of breast epithelial cells. Subconfluent cell cultures of wild-type or mutant p53 breast epithelial cells were transfected with neomycin-resistant plasmids TAFII70, TAFII80, an equal amount of TAFII70 + TAFII80, or the empty pcDNA vector. After 48 hours, selection of viable colonies was initiated using G418 and maintained for ~3 weeks, at which point the remaining cells were stained and colonies >100 µm in diameter were counted. Each experiment was done twice and in triplicate each time. A. Representative plates of MCF7 cells stained with Giemsa after selection. B. Immunoblot of total protein detected for TAFII70/TAFII80 from MCF7 cells transfected with pcDNA (lane 1), TAFII70 (lane 2), and TAFII80 (lane 3). C. Results from all cell lines tested in this assay with results expressed as a percentage of the number of colonies produced by the pcDNA vector after G418 selection. No colonies were formed in the T47D cells with the TAFII70 vector.

 
TAFII70 Induces a G2 Arrest
We next did cell cycle analyses to determine the nature of the growth suppressive effect of TAFII70. Several cell lines were analyzed after transient transfection with the TAFII70 expression vector. No increase in the fraction of apoptotic cells was noted in any experiment compared with the pcDNA control transfections. In all cases, however, an increased number of cells in G2-M was observed (Fig. 3A). Again, this effect was independent of p53 status. To determine if the cells were arrested in mitosis or in G2, transfections with the expression vector or control plasmid together with a green fluorescent protein (GFP) expression vector were done. The cells were allowed to recover and treated with nocodazole. Transfected cells (GFP positive) with condensed chromatin were counted 24 hours after treatment (Fig. 3B). Cultures transfected with pcDNA contained a high percentage of cells arrested in mitosis, whereas those transfected with TAFII70 showed significantly fewer cells with condensed chromatin. In contrast, overexpression of TAFII80 did not inhibit transit into mitosis (data not shown). Together with the accumulation of cells in G2-M as assessed by flow cytometry (Fig. 3A), these data indicate that TAFII70 overexpression induces an arrest in the G2 phase of the cell cycle.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 3. TAFII70 mediates p53-independent G2 arrest. A. Subconfluent cell cultures were transiently transfected with constructs encoding the GFP (1 µg; to monitor transfection efficiency) and TAFII70 (5 µg; or pcDNA as a control). After 24 hours, cells were trypsinized, fixed, and stained for DNA content with propidium iodide. GFP-positive cells were analyzed for DNA content by flow cytometry. Columns, average percentage of cells with a 4N DNA content from at least two experiments for each cell line. B. Twenty-four hours after transfection, cells were exposed to nocodazole (0.4 µg/mL) to arrest cycling cells in mitosis. On the next day, cells were fixed and stained with propidium iodide to visualize chromatin. Mitotic cells were identified by their condensed chromatin. Columns, percentage of cells in mitosis from an average of three experiments in which 500 cells were randomly counted per culture. {blacksquare}, pcDNA; {square}, TAFII70.

 
Differential TAFII70 Isoform Expression in Cancer versus Normal Breast
Given the difference in biological activity between the two primary isoforms, we examined the levels of these transcripts and proteins in a series of breast cancer and normal/benign breast specimens. Quantitative RT-PCR was done based on SYBR Green accumulation with primers specific for each of the two major splice variants. Amplifications were designed to produce products of nearly equal lengths (284 bp for TAFII70 and 263 bp for TAFII80), and a single product was observed (both by melting curve analysis and gel electrophoresis) in all cases. Total RNA was extracted from frozen breast specimens after determining that the content of tumor or normal epithelia was >50% on a per cell basis. Representative RT-PCR products for a series of normal and breast cancer specimens and a scatter graph of the quantitated results are shown in Fig. 4. Results are expressed as a ratio of the two PCR products. The mean ratio of TAFII80 to TAFII70 in the 13 normal/benign breast specimens was 0.33 compared with a ratio of 2.5 for the 33 breast cancers (t test, P < 0.001). The ratio of isoform expression in normal breast cells and specimens was tightly clustered, with most exhibiting higher expression of TAFII70 than TAFII80. The breast cancers showed a much larger range of relative isoform expression, with the majority expressing significantly higher levels of TAFII80 than TAFII70. All of the cancers were of the invasive ductal histologic type, whereas the benign breast tissues were derived from a combination of reduction mammoplasties, benign proliferative disorders such as fibroadenoma, and coexisting normal breast tissue obtained at the time of surgery for breast cancer. For three cases, we tested both tumor and normal breast tissues from the same patient. In each case, expression of the TAFII80 isoform predominated in the cancer, and TAFII70 was the more highly expressed isoform in the coexisting normal tissue obtained from the same surgical procedure.



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 4. Ratio of TAFII70 to TAFII80 isoforms varies between cancer and normal breast epithelia. Expression of the two primary coding variants was measured by quantitative RT-PCR and immunoblotting in a series of normal breast epithelial samples, normal breast cell lines and cultures, and primary breast cancers. A. Representative ethidium-stained gel of products from RT-PCR showing levels of TAFII70 and TAFII80 using isoform-specific primers. B. Scatter plot comparing the ratio calculated from quantitative RT-PCR of the two isoforms in cancer versus normal breast samples. Mean values are indicated for each set. C. Immunoblot of a representative set of cancer and normal breast epithelial samples detected for TAFII70/TAFII80. Lanes 10 and 11, MCF10A cells transfected with TAFII70 and TAFII80, respectively, to indicate the relative positions on the gel.

 
Due to the heterogeneity of breast specimens, both tumor and normal, differences in isoform expression could be due to varying composition of the tissue specimens. Therefore, we also did laser capture microdissection to isolate pure populations of epithelial cells from a subset of the normal and cancer specimens shown in Fig. 4. In the microdissected malignant epithelium, the ratio of TAFII80 to TAFII70 was higher, whereas the ratio in dissected normal epithelium was lower when compared with the bulk isolated RNA from the same specimen. This further supports the finding that TAFII80 in cancer and TAFII70 in normal breast epithelium are the predominant forms.

From a subset of these samples, we also examined isoform expression at the protein level. The position of the two protein species (resolved on gradient SDS-PAGE) is indicated by extracts from cells transfected with either TAFII70 (Fig. 4C, lane 10) or TAFII80 (Fig. 4C, lane 11). In primary breast cancers, the ratio of the splice variants is skewed toward the larger TAFII80 isoform, whereas the normal breast specimens all have a higher level of TAFII70. These results mirror the transcript levels of the different isoforms in cancer and normal breast epithelia.

Transcriptional Activation by TAFII70 Isoforms
The putative function of the TAFs is to participate in transcription in the context of the general transcription factor, TFIID. Whereas these factors may influence the transcription of a broad set of genes, there is also evidence that some genes may be specifically affected (9, 10). Isoform-specific transcriptional activity could serve to explain the observed disparity in growth suppression. To test this hypothesis, the normal breast epithelial line, MCF10A, was transiently transfected with TAFII70, TAFII80, or the parental pcDNA vector, and total RNA was used to prepare probe for hybridization to Affymetrix gene chip arrays (U95, ~12,000 probe sets). Duplicate cultures were transfected with each vector and hybridized to separate chips. Results from these experiment showed a remarkable absence of a dramatic transcriptional effect by either TAFII70 or TAFII80 compared with the pcDNA control transfection. Genes with >2-fold change in expression from both independent experiments are listed in Table 1. Using this criterion, we separated these genes into four classes: (a) genes induced by both TAFII70 and TAFII80, (b) genes induced by TAFII70 alone, (c) genes repressed by both TAFII70 and TAFII80, and (d) genes repressed by TAFII70 alone. None of the genes that are specifically affected by TAFII70 have an obvious link to growth arrest. One gene linked to G2 arrest that did come out of this screen is GADD45a; however, it was induced equally by both TAFII70 isoforms. Bell et al. (8) also showed increased levels of GADD45a transcript after introduction of TAFII70. Overexpression of GADD45a in breast epithelial cells results in growth suppression, G2 arrest, and reduced colony formation analogous to TAFII70 (11).


View this table:
[in this window]
[in a new window]
  		Table 1. Genes Affected by Ectopic TAFII70 and TAFII80

 
Because GADD45a is an obvious candidate gene that could mediate the G2 arrest phenomenon, we further verified the array data by Northern blotting (Fig. 5). Again, total RNA was derived from MCF10A cells transfected with pcDNA, TAFII70, or TAFII80 expression vectors. The levels of GADD45 mRNA were elevated to the same degree after expression of both isoforms confirming the array analysis. Immunoblotting again showed that the different TAF isoforms were expressed at comparable levels in this transfection. We concluded from these experiments that GADD45a expression is induced but, in and of itself, cannot account for the different biological effects of the TAFII70 isoforms.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 5. TAFII70 and TAFII80 induce expression of the endogenous GADD45 transcript. MCF10A cells were transfected with pcDNA, TAFII70, or TAFII80 together with a GFP expression vector. After 24 hours, GFP-positive cells were physically sorted by flow cytometry. Total RNA and protein was extracted. TAFII70 and TAFII80 protein products were detected by immunoblotting, and GADD45 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were detected by Northern blotting.

 
Interaction of TAFII70 and GADD45a Proteins
The histone fold motifs that occur in several TAFs likely facilitate protein-protein interactions and perhaps promote assembly of transcriptional complexes directly onto DNA (7, 12). The difference between TAFII70 and TAFII80 proteins is an additional 49 amino acids at the NH2 terminus of TAFII80 that contains a high percentage of proline residues. The first helix of the histone fold motif begins at residue 14 in the TAFII70 sequence. The additional protein sequence may have consequences for the secondary structure in the characteristic helix-loop-helix-loop-helix of the histone fold. The single gene induced by TAFII70 that does have a defined role in G2 arrest is GADD45a. In addition, GADD45a has been implicated in the accessibility of topoisomerase I to modified chromatin (13). From these connections, we investigated whether either TAFII70 or TAFII80 physically interacts with the GADD45a protein.

In vitro transcribed and translated with [35S]methionine, GADD45a and TAFII70/TAFII80 proteins were synthesized and subjected to immunoprecipitation (Fig. 6A). Nearly equal levels of TAFII70 and TAFII80 were synthesized in these reactions (lanes 1 and 2); however, when pulled down with an antibody to GADD45a, TAFII70, but not TAFII80, was coprecipitated (lanes 3 to 6). Next, to determine whether this interaction could be detected in cells, we constructed a vector expressing full-length GADD45a with the V5 epitope in frame at the COOH terminus. This construct was cotransfected with TAFII70, TAFII80, or pcDNA into MCF10A cells, and protein extracts were prepared. These extracts were immunoprecipitated with monoclonal antibodies to either TAFII70/TAFII80 or the V5 epitope. After transfer, the blots were cut and probed with antibodies to these proteins (Fig. 6B). Using the V5 antibody for immunoprecipitation, the TAFII70 protein was clearly detected by immunoblotting (lanes 1 to 3). Little or no TAFII80 could be seen in this immunoprecipitation. The same extracts subjected to immunoprecipitation with anti-TAFII70/TAFII80 antibody revealed high levels of both TAFs (lanes 4 to 6). Detecting with an antibody to GADD45a showed that this protein is clearly present in an immunoprecipitated complex when TAFII70, but not TAFII80, is expressed.



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 6. GADD45 physically associates with TAFII70 but not with TAFII80. A. In vitro association of [35S]methionine-labeled GADD45 and TAFII70 is showed by coimmunoprecipitation of the two protein products using an antibody to GADD45. Lanes 1 and 2, in vitro coupled transcription/translation products of TAFII70 and TAFII80 primed reactions. Lanes 3 to 6, immunoprecipitations of GADD45 together with the indicated transcription/translation reactions (bottom). Asterisk, position of a faint product that is present in all immunoprecipitated lanes that does not correspond to either TAFII70 or TAFII80. B. In vivo association of TAFII70 and GADD45 is showed by transfection of either TAFII70 or TAFII80 along with a V5 epitope-tagged GADD45 expression vector into MCF10A cells. Immunoprecipitation with anti-V5 antibody (lanes 1 to 3) and detected with anti-TAFII70/TAFII80 (upper panel) and anti-V5 (lower panel). Immunoprecipitation with anti-TAFII70/TAFII80 (lanes 4 to 6) and detected with anti-TAFII70/TAFII80 (upper panel) and anti-V5 (lower panel). IgG light chain (IgG-L) from the immunoprecipitated antibody is detected in all lanes. C. The same experiment (B) as done with HA-tagged GADD45 and TAFII70 (lane 1) and HA-tagged deletion constructs of GADD45 (lanes 2 and 3). D. Coimmunoprecipitations with cells transfected with TAFII70 + GADD45 mutants. Upper panel, an immunoblot detecting total levels of GADD45; lower panel, an immunoblot for GADD45 after immunoprecipitation with anti-TAFII70. In each case, the two internal deletions (Del50-76 and Del 50-95) fail to interact with TAFII70. M62-67 has diminished interaction with TAFII70 compared with wild-type and the other missense mutations, M74-79 and M82-87. E. Cell line that stably overexpresses TAFII70 no longer exhibits interaction with GADD45. MCF7 cells stably overexpressing TAFII70 or TAFII80 were transfected with GADD45-HA and harvested 24 hours later. Protein extracts were subjected to immunoprecipitation with either anti-TAFII70 or anti-HA. After electrophoresis, immunoprecipitates were blotted with antibodies to TAFII70 and HA. Exposure for the presence of TAFII70/TAFII80 was different than the others due to the extreme intensity of the signal.

 
Similar experiments were done with GADD45a deletion and mutation constructs tagged with hemagglutinin (HA; Fig. 6C and D) to determine the interacting domain and verify that the interaction does not depend on the V5 polypeptide sequence. NH2-terminal (16-165) and COOH-terminal (16-105) truncation mutants of the 165–amino acid GADD45a coding sequence both coprecipitated with TAFII70 (Fig. 6C), indicating that the central portion of the protein contains the interacting domain. Toward probing this region further, we obtained an additional series of GADD45a mutants that had been used previously to define functional (G2 arrest) and structural (interaction with the CDC2 protein) aspects of GADD45 (14). Internal deletions (Del50-76 and Del50-95) both failed to coprecipitate with TAFII70 (Fig. 6D). These mutants could not be expressed at high levels, but on extended exposures and through multiple independent experiments, no evidence of the interaction could be detected. Of note, the minimal domain of GADD45 required for G2 arrest was also mapped to amino acids 50 to 76 (14). Mutations altering five amino acid stretches within this internal domain were also tested. These sites were chosen for being the most highly conserved among the GADD45 family members ({alpha}, ß, and {gamma}) and were changed to code for strings of alanines. The three mutations in this series (M62-67, M74-79, and M82-87) all coprecipitated with TAFII70; however, M62-67 exhibited the weakest complex. Again, of note is that the M62-67 mutation failed to induce a G2 arrest or form a detectable complex with CDC2. Therefore, the domain responsible for interaction of GADD45 with TAFII70 seems to fully overlap with that shown previously to complex with CDC2 and lead to G2 arrest.

Whereas TAFII70 dramatically suppressed colony formation (Fig. 2), some of the colonies that did form continued to grow and overexpress the 70-kDa isoform. Individual G418-resistant MCF7 colonies from TAFII70, TAFII80, and pcDNA transfections were cloned and analyzed for transgene expression and growth characteristics. Clones with comparable growth rates were expanded and analyzed to determine whether the interaction between TAFII70 and GADD45a was maintained concomitant with TAFII70 overexpression (Fig. 6E). Coimmunoprecipitation/immunoblotting revealed that whereas TAFII70 protein levels were maintained at high levels after 2 months in continuous culture, the interaction with GADD45a could no longer be detected. This result suggests that the association between GADD45a and TAFII70 has direct or indirect functional significance with respect to growth inhibition.

GADD45a Null Cells Are Not Susceptible to TAFII70 Inhibition
To directly test whether GADD45a was required for TAFII70 growth suppression, we did colony formation assays on mouse embryo fibroblasts derived from GADD45a knockout mice (15). Two independent pairs of lines were used in these assays, one pair that underwent spontaneous immortalization and another pair that was immortalized by introduction of human papilloma virus E7 and activated H-ras (designated "ER"). Mouse embryo fibroblast cell lines from GADD45 –/– and wild-type (+/+) littermates were transfected with pcDNA, TAFII70, or TAFII80 and selected with hygromycin. TAFII70 significantly inhibited colony formation of both wild-type lines but did not diminish the selective growth of either of the GADD45 null cell lines (Fig. 7). In contrast, GADD45 status was not a factor in TAFII80-related colony formation. Both wild-type and null cells showed only slight inhibition when transfected with TAFII80 compared with the pcDNA control transfections. These results indicate that TAFII70 exerts growth suppression through GADD45a, either directly or indirectly, whereas the activity of TAFII80 in this regard does not depend on the presence of GADD45.



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 7. Colony formation of GADD45 wild-type and null cells in the presence of TAFII70 isoforms. Mouse embryo fibroblast cell lines derived from GADD45 –/– and +/+ mice were cotransfected with pTK-Hyg and either pcDNA, TAFII70, or TAFII80. Transfected cultures were selected with 100 µg/mL hygromycin for 2 weeks and stained with a modified Giemsa, and colonies >100 µm in diameter were counted. Results are from three separate experiments, and colony counts are expressed as a percentage of the pcDNA control from each experiment. Four cell lines were used in these experiments: spontaneously immortalized GADD45 +/+ and –/– and E7 + ras (ER) immortalized GADD45 +/+ and –/–.

 

   Discussion
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
Materials and Methods
 References
 
Much of the tumor suppressor activity ascribed to p53 is likely mediated through its effects on transcription (16-18). P53 can induce the transcription of genes by direct binding to DNA sequence elements, and this activity is essential for its growth suppression properties (19-22). The p53 protein bound to a cognate DNA element seems to promote the association of TFIID (TATA box binding factor) and the general transcription factor, TFIIA (23-25). The assembly of this transcription complex may be mediated through physical interaction between p53 and certain TAFs (3, 4, 6). Whereas TFIID and TFIIA are part of the general transcription machinery, the interaction with p53 makes them potential targets for oncogenic events, particularly the TAF components that mediate this interaction. It was from this perspective that the current study was initiated.

Of the five alternatively spliced forms of TAFII70 that have thus far been described, we found that three of these predominate in breast epithelial cells. Two of these splice variants code for different proteins, TAFII80 (726 amino acids) and TAFII70 (677 amino acids lacking the NH2-terminal 49 amino acids of TAFII80). In our initial characterization of these two isoforms, we found that overexpression of TAFII70, but not TAFII80, caused a dramatic growth suppression of breast epithelial cells, both normal and cancer derived, expressing wild-type or mutant p53. This growth suppression is attributable to an arrest in the G2 phase of the cell cycle preventing entry into mitosis. The only cell line that was equally affected by both TAFII70 and TAFII80 expression was HCC1937, a breast cancer line harboring hemizygous BRCA1 and p53 mutations. From these data, we concluded that TAFII70 was likely not acting through specific enhancement of p53 transcriptional activity. This was further supported by a series of transient expression assays on p53 responsive promoters that showed no stimulation of p53-mediated transcription by TAFII70 or TAFII80 in breast epithelial cell lines (11).

Because there was a dramatic biological difference between the two major protein isoforms, we examined their expression in a series of breast cells and primary breast tissues. By quantitative RT-PCR, we found that the ratio between the isoforms was skewed toward TAFII70 in normal breast epithelium and toward TAFII80 in breast carcinomas. There was ~7-fold difference in the median ratio between cancer and normal. This differential expression translated into differences in protein accumulation as well. Varying mixtures of the two isoforms may affect the assembly and function of TFIID and other TAF-containing complexes. Evidence from yeast TFIID suggests that there are four core TAFs that form an octamer complex (two copies of each). Three of these TAFs contain a histone fold domain (including the yeast homologue of TAFII70, yTAF60). Disruption of the histone fold disrupts the octamer, and overexpression of a wild-type TAF can overcome the effects of a temperature-sensitive mutation in the histone fold domain (7).

In searching for the basis of the specific G2 arrest induced by TAFII70, we examined downstream genes that might be affected. GADD45a, well known to participate in G2 arrest, was induced at the mRNA level by transient expression of TAFII70. Overexpression of GADD45a could explain the observed phenotype; however, it was induced to an equal degree by TAFII80. Bell et al. (8) have also shown that the {delta} isoform of TAFII70 (lacking 10 amino acids in the histone fold motif) induces GADD45a expression. As opposed to the G2 arrest that we have observed in breast cells, expression of either TAFII70 or the {delta} isoform in HeLa cells resulted in an apoptotic response. Consistent with the disruption of the histone fold motif in the {delta} isoform, Bell et al. suggested that an altered association with another histone fold containing TAF (TAFII31) could mediate the apoptotic activity of this isoform. By RT-PCR, we have detected expression of the {delta} isoform in breast cells; however, it is in relatively low abundance compared with TAFII70{alpha} and TAFII70ß. Nonetheless, their study does provide precedent for isoform-specific action of this TAF.

In further pursuing the differential action of TAFII70 and TAFII80, we did a global transcriptional analysis using expression arrays. The most surprising aspect of this experiment was the relatively small impact that overexpression of either of these transcriptional accessory factors had on steady-state transcript levels. The short list of genes consistently affected by overexpression of either isoform includes GADD45a. Genes induced at least 2-fold by TAFII70 alone include S100A3, UNC13, NDUFS6, the vitamin D receptor, STAT1, PCTAIRE2BP, and OAS1. Of these genes, the vitamin D receptor can mediate cell cycle effects combined with pharmacologic doses of vitamin D or its analogues (26, 27). STAT1 may have a positive or negative influence on cell growth; however, these effects stem largely from phosphorylation followed by nuclear translocation of the protein (28). From these data, there was not a compelling case to be made that a specific transcriptional activation event was the root cause of TAFII70 growth suppression.

Because GADD45a was the most obvious common gene implicated in the G2 arrest phenomenon, we focused on possible interactions with this protein. This became a logical investigation for several reasons:

  1. Overexpression of GADD45a results in the same growth suppression and G2 arrest phenotype observed with TAFII70 (29).
  2. Both TAF isoforms induce expression of GADD45, but only TAFII70 has an effect on growth.
  3. GADD45a protein is found in a complex with several other proteins including proliferating cell nuclear antigen, p21, CDC2, and core histones (13, 29-33).

Through its interaction and inhibition of the CDC2 kinase, GADD45a is believed to mediate its G2 checkpoint effect (33, 34). Therefore, if both TAF isoforms induce GADD45 but only one is able to bind the protein, perhaps via its interaction with the histone fold motif, this could serve to explain the observed phenomenon.

Our findings in this regard were somewhat surprising and counter to our expectations. We found that TAFII70, but not TAFII80, formed a protein complex with GADD45a. This interaction was specific whether we captured TAFII70 first or GADD45a. Using a series of deletion mutations in GADD45a, the interaction domain was mapped to amino acids 50 to 76. This is the same region of the protein that is also required for binding to CDC2 and inducing G2 arrest (14). In addition, colocalization studies indicated that TAFII70, but not TAFII80, shares the same subcellular distribution with GADD45a (data not shown). Further, cell lines that managed to overcome TAFII70-mediated growth inhibition do not contain demonstrable TAFII70-GADD45 complexes. Finally, TAFII70-specific growth inhibition was completely abrogated in GADD45a null cells.

The functional significance of this complex is not known; however, a study by Carrier et al. (13) provides possible insight. Their work showed that GADD45a directly associates with core histones and can facilitate topoisomerase relaxation and cleavage activity on nucleosomes. The interaction is increased by histone acetylation or UV irradiation. The implication from this work is that GADD45a recognizes altered chromatin and perhaps recruits repair complexes to these sites. In addition to inactivation of CDC2 kinase, this may be another mechanism through which GADD45a promotes cell cycle arrest. TAFII70 is one of the four TAFs to form a histone fold octamer (7). This octamer is similar in several respects to the analogous structure formed by the core histones. Therefore, the recruitment of GADD45a to this structure should not be entirely unexpected. All indications are that this TAF structure is associated with chromatin; therefore, nucleating GADD45a to this structure may have the same consequences as when it contacts nucleosomes. The relative level of the two isoforms in cancer versus normal breast may be functionally significant, particularly in the component of DNA damage response that is mediated by GADD45a. Cancers have a higher relative level of the TAFII80 isoform that fails to complex with GADD45. This could serve to blunt the growth arrest and/or DNA repair process.

One other interesting aspect of this work relates to the single cell line that showed equivalent growth suppression with both TAFII70 and TAFII80 expression. The HCC1937 breast cancer cell line contains a hemizygous inactivating frameshift mutation in the BRCA1 gene (5283insC). There is now a firm link between BRCA1 and the G2 checkpoint (35, 36), and one of the primary genes induced on BRCA1 expression is GADD45a (1, 37, 38). This suggests that GADD45a is involved in BRCA1-mediated G2 arrest (39). Unlike most other breast cancer cell lines and tissues, HCC1937 cells have high basal levels of GADD45a mRNA (11), suggesting that there is a negative feedback loop with BRCA1. A significant body of evidence implicates the involvement of BRCA1 with normal and damaged chromatin (40-43). Because we must postulate that differences in conformation or protein-protein interactions lead to the difference in GADD45a binding, equivalent growth suppression by the two TAFII70 isoforms in HCC1937 cells raises the possibility that BRCA1 may influence the binding or conformation of GADD45a or the histone-like TAFs.


   Materials and Methods
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
References
 
Cell Culture
The human breast cancer cell lines MCF7, MDAMB468, SKBR3, T47D, and ZR75-1 were obtained from American Type Culture Collection (Manassas, VA) and maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum (Life Technologies, Inc., Rockville, MD). Normal breast epithelial cultures and lines were also used in these studies. All of these cells were cultured in DFCI-1 medium (44). The 26N, 40N, and 48N primary human mammary epithelial cells were obtained from three separate reduction mammoplasties. The 26NC cell line is a chemically immortalized (dimethylbenzanthracene) derivative of the 26N culture and has been maintained in our laboratory for over 6 years (45). The BE20E6 (E6) line was immortalized by stable transfection of a plasmid containing the human papilloma virus E6 gene (provided by Ray White, University of Utah, Salt Lake City, UT), and MCF10A are spontaneously immortalized adherent mammary epithelial cells obtained from the Michigan Cancer Foundation (Detroit, MI). DU99 cells are telomerase-immortalized normal human mammary epithelial cells.

Mouse embryo fibroblast cell lines derived from GADD45 null mice and control littermates (provided by M.C. Hollander, National Cancer Institute, Bethesda, MD) were grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (15). Two pairs of these cell line were used: (a) spontaneously immortalized GADD45 +/+ and –/– fibroblasts and (b) fibroblasts immortalized via expression of human papilloma virus E7 plus H-ras V12 (+/+ ER and –/– ER).

Tissue Specimens
Tissues were obtained from Duke University Medical Center (Durham, NC) only after it was determined that there was sufficient material for diagnosis under a Duke institutional review board–approved protocol. These specimens were flash frozen and maintained in the Duke Breast Cancer SPORE Tissue Bank at –135°C with associated clinical and pathologic data kept in a password-protected database. Before extraction, all specimens were sectioned and stained with H&E to evaluate the percentage of cancer and normal epithelia. Only tissues that were predominantly of the appropriate cell type were used for this study. Total RNA and protein were extracted from these specimens as described previously (46). For laser capture microdissection, tissues were sectioned at 5 µm, dehydrated, and stained with hematoxylin (47). A PixCell II (Arcturus, Mountain View, CA) microscope was used to obtain pure populations of epithelial cells from normal and neoplastic frozen specimens. RNA was extracted using the Stratagene Micro RNA Isolation Kit (La Jolla, CA) according to the manufacturer's recommendations.

Plasmids
Human TAFII70 was subcloned from the expression vector pET-TAFII70 (provided by R. Tjian, Berkeley University, Berkeley, CA) into pcDNA3.1. The sequence of this plasmid was confirmed by resequencing and was verified to code for the 677–amino acid (predicted Mr 72.7 kDa) form termed TAFII70{alpha}(48). TAFII80 (TAFII70ß, 726 amino acids, predicted Mr 77.9 kDa) was cloned from a PCR product into the same vector and sequence verified. The GADD45a cDNA was amplified by PCR and cloned in-frame into the pcDNA-DEST40 vector with a COOH-terminal V5 tag. The pcDNA3-GADD45-HA and deletion/mutation constructs thereof were kindly provided by Dr. Xinwei Wang (NIH, Bethesda, MD; ref. 13).

Colony Growth Inhibition Assays
Cells were transfected with 5 µg of the neomycin-resistant expression vector pcDNA3.1, pcDNA3.1-TAFII70, or pcDNA3.1-TAFII80. 26NC cells were seeded at 2.5 x 105 per 60 mm dish, and all other cells were seeded at 5 x 105 per 60 mm dish 1 day prior to transfection. Cells were washed in reduced serum medium (Opti-MEM I, Life Technologies) and transfected using the Superfect transfection reagent (Qiagen, Valencia, CA). Cells were incubated with the Superfect reagent for 3 hours, at which time the medium was aspirated and replaced. Selection of viable transfected cells was initiated 48 hours later with geneticin/G418 sulfate (Life Technologies). Cells were maintained in culture in their respective medium containing 10% fetal bovine serum plus 600 µg/mL G418 (or 100 µg/mL G418 for 26NC cells) for ~3 weeks. G418-resistant cells were stained with a modified Giemsa stain (Sigma Chemical Co., St. Louis, MO), and colonies ≥100 µm in diameter were counted by visual examination.

On parallel plates of MCF7 cells transfected with TAFII70, TAFII80, and pcDNA, G418-resistant colonies were isolated using cloning cylinders. These clones were propagated individually and tested for continued elevated expression of the exogenous transgene by immunoblotting. Clones that continued to express high levels of TAFII70 and TAFII80 were expanded and stored.

Immortalized mouse embryo fibroblasts were cotransfected with pTK-Hyg (Clontech, Palo Alto, CA), and either pcDNA, TAFII70, or TAFII80 using Lipofectin (Invitrogen, Carlsbad, CA) was selected for 2 weeks in the presence of 100 µg/mL hygromycin (Sigma Chemical). Colonies were stained and scored as described above.

Cell Cycle Analysis
To examine cell cycle effects mediated by TAFII70, cells were seeded in 60 mm dishes at 3 x 105 cells per dish and transfected with 5 µg of pcDNA or the pcDNA-TAFII70 construct and 1 µg of pEGFP-NI (Clontech; expressing GFP) using GenePorter (Gene Therapy Systems, San Diego, CA). After 24 hours, cells were stained for DNA content with propidium iodide. Briefly, cells were trypsinized and fixed in 2% paraformaldehyde for 30 minutes at room temperature. After washing with PBS, cells were permeabilized with 70% ethanol (in PBS) at 4°C for 30 minutes. Cells were washed in PBS and resuspended in 0.5 mL of PBS containing 100 µg/mL RNase A and 50 µg/mL propidium iodide (Life Technologies), and DNA content was quantitated by flow cytometry.

Mitotic Index Assays
Cells were seeded at 1 x 104 in chamber slides and transfected with pcDNA or TAFII70 using GenePorter. On the next day, the medium was replaced with fresh medium containing 0.4 µg/mL nocodazole (Sigma Chemical). After 24 hours, cells were fixed with 3% paraformaldehyde for 30 minutes at room temperature. After washing in PBS, cells were stained with a propidium iodide solution containing 500 µg/mL RNase A and 50 µg/mL propidium iodide (Life Technologies) and incubated at 4°C for 30 minutes. For each sample, 500 cells were randomly counted by fluorescent microscopy. Mitotic cells were scored based on their lack of nuclear membrane and evidence of chromosome condensation. All assays were done in triplicate.

Transcriptional Activation by TAFII70 and Northern Blotting
TAFII70, TAFII80, or pcDNA were cotransfected with an enhanced GFP expression vector (pIRES2-EGFP, Clontech). After 24 hours, transfected cells were physically sorted by flow cytometry based on the GFP signal. Total RNA was isolated from the GFP-positive cells using Qiagen RNeasy kits. For Northern blots, RNA (5 µg) was electrophoresed on a 1% agarose-formaldehyde gel and transferred onto a nylon membrane (ICN Pharmaceuticals, Inc., Costa Mesa, CA). Hybridizations were done as described previously (49).

Quantitative RT-PCR
Real-time PCR for TAFII70- or TAFII80-specific sequences was done using the LightCycler system (Roche Diagnostics, Indianapolis, IN) according to the manufacturer's instructions. The primers were TAF80QT1F (TTCTTTTTCTTCTGCCTGCCC), TAF80QT1R (ACTTCAAGGCATCCTGTGCG), TAF70QT1F (ACGGTTGGTTGTGTGTCTGTGCTC), and TAF70QT1R (TTCCCTGGCGAACTCCTACGAATC). A standard reaction mixture contained 2 µL Titanium PCR buffer (Clontech), 1 µL 100x bovine serum albumin (New England Biolab, Beverly, MA), 1x SYBR Green I (Molecular Probes, Eugene, OR), 0.5 mmol/L deoxynucleotide triphosphates, 0.25 µmol/L forward and reverse primers, 1x AdvanTaqPlus polymerase (Clontech), and 5 ng cDNA. A typical cycling profile included a hot start at 95°C for 120 seconds followed by 40 cycles of a denaturation step at 95°C denaturation for 0 second, 58°C annealing for 10 seconds, 72°C of extension for 12 seconds, and a fluorescent signal detection at the melting temperature of 88°C. The standard curve was generated from a serial dilution of TAFII70 or TAFII80 plasmid.

Gene Chip Expression Analysis
MCF10A cells were transfected with TAFII70, TAFII80, or pcDNA using GenePorter. Total RNA was extracted 18 hours after transfection. Parallel transfections were done for protein extraction to verify that the transfection produced high levels of the desired protein. The human U95 array (Affymetrix, Santa Clara, CA) was hybridized with a cRNA probe as described previously (46). The experiment was repeated with RNA derived from a different transfection several weeks later. Data were analyzed using Affymetrix software to rank order genes that were induced or repressed compared with the pcDNA control transfection.

Immunoblotting and Immunoprecipitation
Whole cell protein lysates were obtained from log-growing cells using 1% NP40 lysis buffer [150 mmol/L NaCl, 50 mmol/L Tris (pH 8), and 1% NP40] supplemented with protease inhibitors. Cells were lysed for 30 minutes at 4°C, and protein concentrations were quantitated using the Bradford assay. Protein (100 µg) was separated by SDS-PAGE and electrotransferred onto nitrocellulose. After blocking in 5% dried milk and PBS-T, TAFII70/TAFII80 was detected using a mouse monoclonal antibody at a 1:200 dilution (Transduction Laboratories, Newington, NH). Chemiluminescence (NEN, Wilmington, DE) was done after incubating blots in an antimouse secondary antibody conjugated to horseradish peroxidase (1:5,000 dilution, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Monoclonal antibodies against the V5 (Invitrogen, 1:5,000) or HA epitope tags (Roche Diagnostics, 1:500) were used to detect GADD45 fusion proteins. Immunoprecipitations were carried out by incubating 2 mg of protein with primary antibodies and protein A/G agarose beads at 4°C for 4 hours. The precipitating material was washed three times, boiled, and subjected to immunoblotting as described above.


   Notes
Top
 Notes
Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
1 NIH grants CA84955 and CA73802 (J.R. Marks).

Note: W. Wang and R. Nahta contributed equally to this work. R. Nahta is currently at Breast Medical Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX. Back

Received May 18, 2004; revised June 21, 2004; accepted June 22, 2004.


   References
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

  1. Jin S, Zhao H, Fan F, et al. BRCA1 activation of the GADD45 promoter. Oncogene 2000;19:4050–7.[CrossRef][Medline]
  2. Martin DW, Munoz RM, Subler MA, Deb S. p53 binds to the TATA-binding protein-TATA complex. J Biol Chem 1993;268:13062–7.[Abstract/Free Full Text]
  3. Lu H, Levine AJ. Human TAFII31 protein is a transcriptional coactivator of the p53 protein. Proc Natl Acad Sci U S A 1995;92:5154–8.[Abstract/Free Full Text]
  4. Thut CJ, Chen JL, Klemm R, Tjian R. p53 transcriptional activation mediated by coactivators TAFII40 and TAFII60. Science 1995;267:100–4.[Abstract/Free Full Text]
  5. Chen X, Farmer G, Zhu H, Prywes R, Prives C. Cooperative DNA binding of p53 with TFIID (TBP): a possible mechanism for transcriptional activation [erratum appears in Genes Dev 1993 Dec;7:2652]. Genes Dev 1993;7:1837–49.[Abstract/Free Full Text]
  6. Farmer G, Colgan J, Nakatani Y, Manley JL, Prives C. Functional interaction between p53, the TATA-binding protein (TBP), and TBP-associated factors in vivo. Mol Cell Biol 1996;16:4295–304.[Abstract]
  7. Selleck W, Howley R, Fang QJ, et al. A histone fold TAF octamer within the yeast TFIID transcriptional coactivator. Nat Struct Biol 2001;8:695–700.[CrossRef][Medline]
  8. Bell B, Scheer E, Tora L. Identification of hTAF(II)80{delta} links apoptotic signaling pathways to transcription factor TFIID function. Mol Cell 2001;8:591–600.[CrossRef][Medline]
  9. Freiman RN, Albright SR, Zheng S, Sha WC, Hammer RE, Tjian R. Requirement of tissue-selective TBP-associated factor TAFII105 in ovarian development [comment]. Science 2001;293:2084–7.[Abstract/Free Full Text]
  10. Weissman JD, Brown JA, Howcroft TK, et al. HIV-1 tat binds TAFII250 and represses TAFII250-dependent transcription of major histocompatibility class I genes. Proc Natl Acad Sci U S A 1998;95:11601–6.[Abstract/Free Full Text]
  11. Nahta R. p53 and the G2 checkpoint in human breast cancer [thesis]. Durham (NC): Duke University; 2000.
  12. Albright SR, Tjian R. TAFs revisited: more data reveal new twists and confirm old ideas. Gene 2000;242:1–13.[CrossRef][Medline]
  13. Carrier F, Georgel PT, Pourquier P, et al. Gadd45, a p53-responsive stress protein, modifies DNA accessibility on damaged chromatin. Mol Cell Biol 1999;19:1673–85.[Abstract/Free Full Text]
  14. Yang Q, Manicone A, Coursen JD, et al. Identification of a functional domain in a GADD45-mediated G2/M checkpoint. J Biol Chem 2000;275:36892–8.[Abstract/Free Full Text]
  15. Hollander MC, Sheikh MS, Bulavin DV, et al. Genomic instability in Gadd45a-deficient mice. Nat Genet 1999;23:176–84.[CrossRef][Medline]
  16. Raycroft L, Wu HY, Lozano G. Transcriptional activation by wild-type but not transforming mutants of the p53 anti-oncogene. Science 1990;249:1049–51.[Abstract/Free Full Text]
  17. Fields S, Jang SK. Presence of a potent transcription activating sequence in the p53 protein. Science 1990;249:1046–9.[Abstract/Free Full Text]
  18. Unger T, Nau MM, Segal S, Minna JD. p53: a transdominant regulator of transcription whose function is ablated by mutations occurring in human cancer. EMBO J 1992;11:1383–90.[Medline]
  19. El-Deiry WS, Tokino T, Velculescu VE, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75:817–25.[CrossRef][Medline]
  20. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993;75:805–16.[CrossRef][Medline]
  21. Chumakov AM, Miller CW, Chen DL, Koeffler HP. Analysis of p53 transactivation through high-affinity binding sites. Oncogene 1993;8:3005–11.[Medline]
  22. Pietenpol JA, Tokino T, Thiagalingam S, El-Deiry WS, Kinzler KW, Vogelstein B. Sequence-specific transcriptional activation is essential for growth suppression by p53. Proc Natl Acad Sci U S A 1994;91:1998–2002.[Abstract/Free Full Text]
  23. Liu X, Miller CW, Koeffler PH, Berk AJ. The p53 activation domain binds the TATA box-binding polypeptide in Holo-TFIID, and a neighboring p53 domain inhibits transcription. Mol Cell Biol 1993;13:3291–300.[Abstract/Free Full Text]
  24. Chang J, Kim DH, Lee SW, Choi KY, Sung YC. Transactivation ability of p53 transcriptional activation domain is directly related to the binding affinity to TATA-binding protein. J Biol Chem 1995;270:25014–9.[Abstract/Free Full Text]
  25. Xing J, Sheppard HM, Corneillie SI, Liu X. p53 Stimulates TFIID-TFIIA-promoter complex assembly, and p53-T antigen complex inhibits TATA binding protein-TATA interaction. Mol Cell Biol 2001;21:3652–61.[Abstract/Free Full Text]
  26. Zhuang SH, Burnstein KL. Antiproliferative effect of 1{alpha},25-dihydroxyvitamin D-3 in human prostate cancer cell line LNCaP involves reduction of cyclin-dependent kinase 2 activity and persistent G1 accumulation. Endocrinology 1998;139:1197–207.[Abstract/Free Full Text]
  27. Kobayashi T, Hashimoto K, Yoshikawa K. Growth inhibition of human keratinocytes by a new vitamin D-3 analogue in vitro. J Dermatol Sci 1998;16:158–64.[Medline]
  28. Bromberg J, Darnell JE. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 2000;19:2468–73.[CrossRef][Medline]
  29. Wang XW, Zhan Q, Coursen JD, et al. GADD45 induction of a G2/M cell cycle checkpoint. Proc Natl Acad Sci U S A 1999;96:3706–11.[Abstract/Free Full Text]
  30. Smith ML, Chen I-T, Zhan Q, et al. Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science 1994;266:1376–80.[Abstract/Free Full Text]
  31. Kearsey JM, Coates PJ, Prescott AR, Warbrick E, Hall PA. Gadd45 is a nuclear-cell cycle-regulated protein which interacts with P21(Cip1). Oncogene 1995;11:1675–83.[Medline]
  32. Maeda T, Hanna A, Sim A, et al. Gadd45 regulates the G2/M checkpoint via cdc2 kinase, DNA repair and cell death in mouse keratinocytes after UV exposure. J Invest Dermatol 2001;117:487.
  33. Zhan QM, Antinore MJ, Wang XW, et al. Association with Cdc2 and inhibition of Cdc2/cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene 1999;18:2892–900.[CrossRef][Medline]
  34. Jin SQ, Tong T, Fan WH, et al. GADD45-induced cell cycle G2-M arrest associates with altered subcellular distribution of cyclin B1 and is independent of p38 kinase activity. Oncogene 2002;21:8696–704.[CrossRef][Medline]
  35. Yarden RI, Pardo-Reoyo S, Sgagias M, Cowan KH, Brody LC. BRCA1 regulates the G2/M checkpoint by activating Chk1 kinase upon DNA damage. Nat Genet 2002 Mar;30:285–9.[CrossRef][Medline]
  36. Xu B, Kim St, Kastan MB. Involvement of Brca1 in S-phase and G(2)-phase checkpoints after ionizing irradiation. Mol Cell Biol 2001;21:3445–50.[Abstract/Free Full Text]
  37. MacLachlan TK, Somasundaram K, Sgagias M, et al. BRCA1 effects on the cell cycle and the DNA damage response are linked to altered gene expression. J Biol Chem 2000;275:2777–85.[Abstract/Free Full Text]
  38. Harkin DP, Bean JM, Miklos D, et al. Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell 1999;97:575–86.[CrossRef][Medline]
  39. Mullan PB, Quinn JE, Gilmore PM, et al. BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents. Oncogene 2001;20:6123–31.[CrossRef][Medline]
  40. Yarden RI, Brody LC. BRCA1 interacts with components of the histone deacetylase complex. Proc Natl Acad Sci U S A 1999;96:4983–8.[Abstract/Free Full Text]
  41. Mallery DL, Vandenberg CJ, Hiom K. Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. EMBO J 2002;21:6755–62.[CrossRef][Medline]
  42. Ye QN, Hu YF, Zhong HJ, Nye AC, Belmont AS, Li R. BRCA1-induced large-scale chromatin unfolding and allele-specific effects of cancer-predisposing mutations. J Cell Biol 2001;155:911–21.[Abstract/Free Full Text]
  43. Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M, Bonner WM. A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol 2000;10:886–95.[CrossRef][Medline]
  44. Band V, Zajchowski D, Kulesa V, Sager R. Human papilloma virus DNAs immortalize normal human mammary epithelial cells and reduce their growth factor requirements. Proc Natl Acad Sci U S A 1990;87:463–7.[Abstract/Free Full Text]
  45. Davis P, Bazar K, Huper G, Lozano G, Marks J, Iglehart JD. Dominance of wild-type p53-mediated transcriptional activation in breast epithelial cells. Oncogene 1996;13:1315–22.[Medline]
  46. West M, Blanchette C, Dressman H, et al. Predicting the clinical status of human breast cancer by using gene expression profiles. Proc Natl Acad Sci U S A 2001;98:11462–7.[Abstract/Free Full Text]
  47. EmmertBuck MR, Bonner RF, Smith PD, et al. Laser capture microdissection. Science 1996;274:998–1001.[Abstract/Free Full Text]
  48. Weinzierl RO, Ruppert S, Dynlacht BD, Tanese N, Tjian R. Cloning and expression of Drosophila TAFII60 and human TAFII70 reveal conserved interactions with other subunits of TFIID. EMBO J 1993;12:5303–9.[Medline]
  49. Marks J, Lin J, Miller D, Lozano G, Herbert J, Levine AJ. The expression of viral and cellular genes in papillomas of the choroid plexus induced in transgenic mice. Prog Clin Biol Res 1988;284:163–86.[Medline]



This article has been cited by other articles:


Home page
 Genes Dev.Home page
J. A. Calarco, Y. Xing, M. Caceres, J. P. Calarco, X. Xiao, Q. Pan, C. Lee, T. M. Preuss, and B. J. Blencowe
Global analysis of alternative splicing differences between humans and chimpanzees
Genes & Dev., November 15, 2007; 21(22): 2963 - 2975.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Q. Chang, D. Bhatia, Y. Zhang, T. Meighan, V. Castranova, X. Shi, and F. Chen
Incorporation of an Internal Ribosome Entry Site-Dependent Mechanism in Arsenic-Induced GADD45{alpha} Expression
Cancer Res., July 1, 2007; 67(13): 6146 - 6154.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
Y. Zhang, D. Bhatia, H. Xia, V. Castranova, X. Shi, and F. Chen
Nucleolin links to arsenic-induced stabilization of GADD45{alpha} mRNA
Nucleic Acids Res., January 18, 2006; 34(2): 485 - 495.
[Abstract] [Full Text] [PDF]

<
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles