
Molecular Cancer Research 2:702-711 (2004)
© 2004 American Association for Cancer Research
Signaling and Regulation
Vav Transformation Requires Activation of Multiple GTPases and Regulation of Gene Expression1
Todd R. Palmby,
Karon Abe,
Antoine E. Karnoub and
Channing J. Der
Department of Pharmacology, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina
Requests for reprints: Channing J. Der, Department of Pharmacology, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, CB 7295, Chapel Hill, NC 27599-7295. Phone: 919-966-5634; Fax: 919-966-0162. E-mail: cjder{at}med.unc.edu
 |
Abstract
|
|---|
Although Vav can act as a guanine nucleotide exchange factor for RhoA, Rac1, and Cdc42, its transforming activity has been ascribed primarily to its ability to activate Rac1. However, because activated Vav, but not Rac-specific guanine nucleotide exchange factors, exhibits very potent focus-forming transforming activity when assayed in NIH 3T3 cells, Vav transforming activity must also involve activation of Rac-independent pathways. In this study, we determined the involvement of other Rho family proteins and their signaling pathways in Vav transformation. We found that RhoA, Rac1, and Cdc42 functions are all required for Vav transforming activity. Furthermore, we determined that Vav activation of nuclear factor-
B and the Jun NH2-terminal kinase mitogen-activated protein kinase (MAPK) is necessary for full transformation by Vav, whereas p38 MAPK does not seem to play an important role. We also determined that Vav is a weak activator of Elk-1 via a Ras- and MAPK/extracellular signal-regulated kinase kinasedependent pathway, and this activity was essential for Vav transformation. Thus, we conclude that full Vav transforming activation is mediated by the activation of multiple small GTPases and their subsequent activation of signaling pathways that regulate changes in gene expression. Because Vav is activated by the epidermal growth factor receptor and other tyrosine kinases involved in cancer development, defining the role of aberrant Vav signaling may identify activities of receptor tyrosine kinases important for human oncogenesis.
Key Words: Dbl family proteins Rho GTPases NF-
B mitogen-activated protein kinases Ras
 |
Introduction
|
|---|
Vav proteins (Vav, Vav2, and Vav3) are members of the Dbl family of proteins that function as guanine nucleotide exchange factors (GEF) and activators of Rho family small GTPases (reviewed in refs. 1-3). To date, 23 mammalian Rho family proteins have been identified of which Rac1, RhoA, and Cdc42 have been the best characterized and most intensely studied (reviewed in refs. 4, 5). Dbl family proteins promote formation of the active GTP-bound protein, and GTPase activating proteins stimulate the formation of the inactive GDP-bound protein. Whereas some Dbl family proteins serve as GEFs for a specific Rho family protein, others exhibit the ability to activate multiple Rho family proteins. For example, Fgd1 is an activator of Cdc42 (6), Lsc is an activator of RhoA (7), and Tiam1 is an activator of Rac (8). By contrast, Vav has been shown to function as a GEF for RhoA, RhoG, Rac1, and Cdc42 (9-12).
Vav and many other Dbl family proteins were identified initially as transforming proteins (1-3). Their transforming activities have been attributed to their ability to cause deregulated activation of Rho family proteins. Thus, like Rho family proteins, Dbl family proteins are regulators of actin cytoskeletal organization, gene expression, and cell cycle progression. Furthermore, constitutively activated mutants of RhoA, Rac1, and Cdc42 exhibit transforming potential (13). Vav is also activated by the epidermal growth factor receptor and other receptor tyrosine kinases (14). Because up-regulated expression and activation of the epidermal growth factor receptor is observed in a wide variety of human cancers (15, 16), Vav signaling may also contribute to epidermal growth factor receptormediated oncogenesis.
Although Vav has been shown to act as a GEF for RhoA, Rac1, and Cdc42 (9-12) and to regulate the actin cytoskeletal changes associated with these three GTPases (6), its transforming activity has been attributed to Rac1 but not to RhoA or Cdc42 activation (17). However, whereas Vav exhibits potent focus-forming activity (18, 19), Rac-specific GEFs do not (20, 21) when assayed in NIH 3T3 focus formation transformation assays. Furthermore, the signaling activities stimulated by Vav important for transformation have not been determined. Studies of effector domain mutants of Rac1, RhoA, and Cdc42 have attributed their transforming potential to their ability to alter gene expression and to promote cell cycle progression rather than to their ability to cause changes in actin cytoskeletal organization (22-25). Whether this is the case for Vav and whether Vav activates signaling pathways independent of those mediated by its Rho family protein substrates have not been determined. In this study, we show that Vav transforming activity is dependent on RhoA and Cdc42 as well as on Rac1. Furthermore, we determined that Vav activation of the nuclear factor-
B (NF-
B) and Jun transcription factors are important for transformation, indicating the importance of altered gene expression in promoting Vav function. Although both Jun NH2-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) are activated by Vav, only JNK is important for Vav transformation. Finally, we implicate the importance of a Ras/MAPK/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK pathway that is independent of Rho family proteins in promoting Vav transformation. When taken together, our observations support the importance of multiple GTPases and their activation of gene expression in promoting Vav transformation.
 |
Results
|
|---|
RhoA, Rac1, and Cdc42 Are Required for Vav Transformation
Although Vav can act as a GEF for multiple Rho family proteins, Vav transforming activity has been ascribed primarily to its ability to activate Rac1 (10, 17). However, whereas activated Vav causes potent focus-forming activity when assayed in NIH 3T3 transformation assays (19, 26), neither activated Rac1 nor Rac-specific Dbl family proteins (e.g., Tiam1) cause significant focus-forming activity (20, 21, 27). Therefore, we speculated that Vav must cause transformation by activation of Rac-independent pathways. Because our previous studies showed that Vav proteins also functioned as a GEF for RhoA and Cdc42 as well as Rac1 (9, 11), we wanted to determine if Vav transformation also required the function of RhoA and Cdc42.
For these analyses, we used various inhibitors of Rho family protein function. First, we employed the widely used dominant-negative mutants RhoA(19N), Rac1(17N), and Cdc42(17N) (27-29). By analogy to the equivalent dominant-negative Ras(17N), these mutants form nonproductive complexes with specific Dbl family proteins that function as a GEF for that particular GTPase (30). We and others have used these mutants to assess the contribution of specific Rho family proteins to the transforming action of other Dbl family proteins (29, 31, 32). Transfection of
N-186 Vav alone caused the appearance of >150 foci of transformed cells per dish (Fig. 1A). Cotransfection of dominant-negative RhoA(19N), Rac1(17N), or Cdc42(17N) caused a 55% to 85% reduction in focus-forming activity, indicating that all three GTPases are important for Vav transformation.

View larger version (22K):
[in this window]
[in a new window]
|
FIGURE 1. RhoA, Rac1, and Cdc42 are required for Vav transformation. A. Coexpression of dominant-negative RhoA(19N), Rac1(17N), or Cdc42(17N) blocked N-186 Vav focus forming. Coexpression of p190RhoGAP also reduced Vav focus-forming activity. NIH 3T3 cells were cotransfected with the pAX142 expression vector encoding N-186 Vav (100 ng/dish) either with 2 µg of the empty pZIP-NeoSV(x)1 expression vector or pZIP-NeoSV(x)1 expression vectors encoding dominant-negative mutants of RhoA, Rac1, Cdc42, or p190RhoGAP. B. Coexpression of the C3 botulinum toxin, an inhibitor of RhoA function, reduces Vav focus-forming activity. NIH 3T3 cells were cotransfected with pAX142 encoding N-186 Vav (100 ng) and either 2 µg of the empty pcDNA3 vector or pcDNA3 encoding C3. C. Coexpression of the isolated Cdc42-binding fragment from WASP reduces Vav focus-forming activity. NIH 3T3 cells were cotransfected with pAX142 encoding N-186 Vav either with 2 µg of the pyDF30 empty vector or pyDF30 encoding WASP-RBD. D. Coexpression of the isolated Rac-binding fragment from Posh or the isolated Rho-binding fragment from Rhotekin reduced Vav focus-forming activity. NIH 3T3 cells were cotransfected with pAX142 encoding N-186 Vav (100 ng) and 2 µg of either the pRK5 empty vector or pRK5 encoding Posh-RBD or Rhotekin-RBD. Columns, averages of three dishes and representative of at least three independent assays.
|
|
Next, we used two other approaches to specifically block RhoA function. Consistent with our observations with the dominant-negative RhoA(19N), we also found that coexpression of p190RhoGAP (33) caused a 80% reduction, whereas coexpression of C3 botulinum toxin (a specific inhibitor of RhoA, RhoB, and RhoC but not Rac1 or Cdc42 function; refs.34, 35) caused essentially a complete inhibition of Vav focus-forming activity (Fig. 1B). Their different abilities to inhibit Vav focus formation are likely to reflect their different mechanisms, and hence efficiencies, of inhibiting RhoA function.
Finally, we used the expression of isolated Rho GTPase binding domains (RBD) of effectors as specific inhibitors of the activated, GTP-bound forms of RhoA, Rac, or Cdc42. The RBD fragment from Wiskott-Aldrich syndrome protein (WASP), a Cdc42-specific effector, has been used as an inhibitor of activated Cdc42 function (36-38). We and others previously used this construct to determine that the Fgd1 Dbl family protein required Cdc42 for its transforming activity (29, 39). Similarly, the isolated binding domain of Rhotekin has been used to show that Dbs transforming activity is dependent on RhoA but not Cdc42 activation (40). We also generated a fragment containing the RBD of Posh (41), a Rac-specific effector, as a specific inhibitor of activated Rac (42). We observed that coexpression of the WASP-RBD, Posh-RBD, and Rhotekin-RBD fragments also reduced Vav focus formation by
50% to 75% (Fig. 1C and D). Taken together with the ability of other approaches to block RhoA, Rac, and Cdc42 function, these results support the contribution of all three GTPases in mediating Vav transforming activity.
NF-
B and JNK Activation Are Required for Vav Transforming Activity
We next determined what downstream signaling activity caused by Vav activation of GTPases contributes to transformation of NIH 3T3 cells. Previous studies showed that Rac1, RhoA, and Cdc42 are activators of the NF-
B transcription factor (43). Because we determined previously that Ras transformation requires the activation of NF-
B (44, 45) and because Ras activation of NF-
B is mediated in part by activation of Rac (46), we determined if Vav transformation is also dependent on activation of NF-
B.
For these analyses, we used expression vectors encoding wild-type (WT) or mutant (AA) versions of I
B to inhibit NF-
B activation. I
B forms a complex with NF-
B in the cytoplasm and prevents the nuclear translocation and activation of NF-
B (47). I
B phosphorylation promotes its degradation, thus releasing and activating NF-
B. The I
B(AA) mutant contains serine-to-alanine substitutions at the two key sites of phosphorylation, thus making it insensitive to degradation and release from NF-
B. We showed previously that coexpression of WT and AA I
B both can block NF-
B activation by Ras,Dbl, and Dbs, causing the inhibition of their transforming activities (32, 44). Therefore, we included activated H-Ras(61L) as a control for these assays. As shown in Fig. 2, coexpression of either WT or AA I
B greatly inhibited H-Ras(61L) and Vav activation of NF-
B in transient expression analyses in NIH 3T3 cells. Similarly, coexpression of WT or AA I
B also blocked H-Ras(61L) and Vav transforming activity in NIH 3T3 focus formation assays (67% and 88%, respectively) for Vav. Thus, NF-
B activation is important for Vav transforming activity.
Previous studies have shown that Rac1 and Cdc42, but not RhoA, causes transient activation of the JNK and p38 MAPKs in NIH 3T3 cells (48, 49). Although JNK and p38 activation is typically associated with apoptotic responses (50, 51), we and others have shown that JNK activation is required for the transforming activity of Ras, Dbl family proteins, and other oncoproteins (13, 52). By contrast, p38 activation has been found to antagonize Ras transformation (52-54). Therefore, we determined if JNK and p38 are activated persistently in Vav-transformed cells and contribute to transformation.
We determined that Vav-transformed NIH 3T3 cells showed persistent activation and phosphorylation of JNK (Fig. 3A). Next, we used two approaches to block JNK activity. First, we used a kinase-dead mutant of SEK1, the upstream activator of JNK, as a reagent to block Vav activation of JNK (55). We showed previously that this mutant protein could block JNK activation by the Dbl and Dbs Dbl family proteins and that SEK1(AL) could block their ability to cause transformation of NIH 3T3 cells (32). As a control for these experiments, we included activated H-Ras(61L) (Fig. 3B). As we have shown previously, coexpression of WT or dominant-negative SEK1 effectively blocked H-Ras(61L) focus-forming activity. Similarly, coexpression of WT or AA versions of SEK1 also caused a significant reduction (
80%) in Vav focus-forming activity. The ability of WT SEK1 to function as a dominant negative is likely to be due to its overexpression and titration of the upstream activators of SEK1.
Second, we used the SP600125 pharmacologic inhibitor of JNK activity (56), which we used previously to determine that JNK activity was required for Ras transformation (52). NIH 3T3 focus formation assays were done with the JNK inhibitor at two concentrations (10 and 20 µmol/L). At the higher concentration, the inhibitor caused a near complete block of
N-186 Vav transformation (Fig. 3C). JNK phosphorylation was reduced when NIH 3T3 cells expressing
N-186 Vav were treated with the JNK inhibitor for the time course of a focus formation assay (data not shown). We conclude that Vav activation of JNK is required for full transformation of NIH 3T3 cells.
p38 Activation Is Not Required for Vav Transforming Activity
The importance of p38 activation in Vav transformation was assessed with a pharmacologic inhibitor that specifically blocks p38 activity. First, Western blotting of cell lysates from stable NIH 3T3 cell lines revealed that activated, phosphorylated p38 was increased in
N-186 Vav cells over vector cells (Fig. 4A). However, when the SB203580 pharmacologic inhibitor was used at two concentrations, it did not significantly affect
N-186 Vav focus-forming activity (Fig. 4B). H-Ras (61L) was used as a control in this experiment to confirm that the inhibitor was working (data not shown). The SB203580 inhibitor increased H-Ras focus formation as was shown previously (52). In addition, we saw a modest decrease in phospho-p38 in NIH 3T3 cells expressing
N-186 Vav that were treated with the p38 inhibitor for a period of time equal to a focus formation assay (data not shown). These data suggest that, although p38 activity is stably up-regulated in Vav-transformed cells, it is not necessary for the transforming activity of Vav.
Inhibition of the ERK/Elk-1 Pathway Blocks Vav Transforming Activity
Although Vav is not a GEF for Ras, there is evidence that Vav may weakly activate Ras and the Raf/MEK/ERK pathway. The mechanism by which Vav may promote this modest degree of Ras activation is not known. For example, we observed previously that Vav-transformed cells showed a modest up-regulation of Ras-GTP and activated ERKs (57). Furthermore, we found that dominant-negative mutants of Ras and ERK could block Vav transforming activity. Despite these observations, it was concluded that Vav transformation was mediated primarily through its ability to act as a GEF for Rho family proteins. However, in light of observations that coexpression of activated components of the Raf/MEK/ERK pathway together with activated Rho family GTPases causes a highly synergistic enhancement of their transforming activity (27, 29, 38, 58, 59), we have reassessed the contribution of a Raf/MEK/ERK pathway to Vav transformation.
For these analyses, we used dominant-negative MEK1(2A) (27, 60, 61) or a pharmacologic inhibitor of MEK1/2 (U0126; refs. 62, 63) to determine if MEK activation was required for Vav transforming activity. First, we compared the ability of Vav and H-Ras to activate Elk-1, a downstream target of the Raf/MEK/ERK pathway (64). Although activated H-Ras(61L) is a potent activator of Elk-1 in transient expression analyses in NIH 3T3 cells (120-fold activation), Vav also caused a weak (5-fold) but reproducible activation of Elk-1 (Fig. 5A). Coexpression of dominant-negative, but not WT, MEK1 essentially abolished the ability of activated Vav and Ras to activate Elk-1 (Fig. 5B). Furthermore, dominant-negative MEK caused a partial reduction in Vav and Ras focus-forming activity (Fig. 5C). Vav focus formation was reduced by >70%. Similarly, analyses with U0126 also showed that this MEK-specific inhibitor blocked Vav and H-Ras activation of Elk-1 in transient expression analyses (Fig. 6A) and Vav and H-Ras focus-forming activity when assayed in NIH 3T3 transformation assays (Fig. 6B). Vav focus formation was reduced by >90%, whereas only a partial reduction was seen for H-Ras and the Ras foci that appeared displayed an altered morphologic appearance similar to those caused by Vav (32). Thus, although Vav is a weak activator of a MEK/ERK/Elk-1 signaling pathway, possibly via Ras activation, these results suggest that this activation contributes to full Vav focus-forming activity. Alternatively, it may suggest that basal ERK activity is important for Vav transformation.
These analyses extend our previous observations (57) and suggest that Vav activation of Ras and the Raf/MEK/ERK pathway can contribute to Vav transformation. However, whether activation of Elk-1 is mediated through this kinase cascade, or instead is mediated by activation of Rho family GTPases, remains possible. Although our previous analyses have determined that in our assay conditions Rac1, RhoA, and Cdc42 are not activators of Elk-1, other studies have shown that these small GTPases can activate Elk-1 (65, 66). To distinguish between these two possibilities, we determined if Ras activation was required for activation of Elk-1. Because Vav activation of Rac1 and Cdc42, and consequently of JNK, should mediate Vav activation of the Jun transcription factor, Ras should not be required for this Vav activity. We found that dominant-negative Ras(17N) caused a 50% inhibition of Vav activation of Elk-1 but no inhibition of Jun activation (Fig. 7). This result is consistent with a mechanism where Vav activates Elk-1 via activation of Ras and the Raf/MEK/ERK pathway.
 |
Discussion
|
|---|
Although Vav proteins can function as a GEF for Rac1, RhoA, and Cdc42, previous studies have determined that Vav transforming activity is mediated through activation of Rac (10, 17). In contrast, our analyses support the importance of all three GTPase targets for Vav transformation. Furthermore, we show that Vav transformation is dependent on multiple signaling pathways that cause activation of various transcription factors. We found that Vav transformation was dependent on activation of NF-
B, the JNK MAPK cascade (activators of the Jun and ATF-2 transcription factors), and Ras-dependent activation of Elk-1. Vav activation of Elk-1 seems to be independent of its ability to serve as a GEF for Rho family GTPases. Thus, we conclude that Vav activation of multiple small GTPases, to cause changes in gene expression, is important for Vav-mediated transformation.
Broek and colleagues used a variety of assays to show that Vav can act as a GEF for Rac1, Cdc42, and RhoA (9). Additionally, Hall and colleagues found that microinjection of Vav into Swiss 3T3 cells caused the stimulation of actin cytoskeletal changes characteristic of activated RhoA, Rac1, and Cdc42 (6). Therefore, it was unexpected that Vav transformation was described to be dependent primarily on Rac activation (10, 17). Furthermore, the much stronger focus-forming activity seen with activated Vav, when compared with activated Rac-specific Dbl family proteins (20, 21), also suggests that Vav transformation is mediated by Rac-independent events. This prompted our interest in reevaluating the importance of other Rho family proteins in mediating Vav transformation. We found that Vav transformation did require the activities of Rac1, as well as Cdc42 and RhoA, for its transforming activity. Thus, the potent focus-forming activity of Vav may be accounted for in part by its ability to cause the coordinate activation of multiple Rho family proteins. These results are consistent with a previous study that showed that coexpression of the activated versions of multiple Rho family proteins can cause highly synergistic focus-forming activities (67). Similarly, it was concluded that Dbl transforming activity also required the activation of all its GTPase substrates (68). The basis for the different conclusions of our study and those described previously (10, 17) is not known. One possibility is that the approaches used in their assays to block RhoA or Cdc42 were not effective to block Vav activation of these other small GTPases. A second possibility may be the use of different strains of NIH 3T3 cells in our respective analyses. We have found that different strains of NIH 3T3 cells can exhibit very distinct abilities to be transformed by effector domain mutants of Ras (69).
Our previous studies that showed that inhibition of JNK or NF-
B activation could block oncogenic Ras transformation (45, 70) suggested the possibility that Vav transformation may also require the activation of these two signaling pathways. Ras activation of JNK and NF-
B is dependent on Rac function. Therefore, because Vav transformation is also dependent on Rac function, it is consistent with our observation that JNK and NF-
B activation are both required for Vav transformation. Thus, although JNK activation is most commonly associated with apoptosis-inducing stimuli, our observations extend the importance of JNK activation for growth promotion by various oncoproteins such as Ras, Abl, or Met (13). Finally, in our analyses of Ras transformation, we determined that NF-
B activation served an antiapoptotic function, because inhibition of NF-
B caused Ras-transformed rodent fibroblasts to undergo apoptosis (45). Whether NF-
B serves such a role for Vav transformation would be interesting to determine. The NF-
B requirement for Vav transformation that we observed may be due to protection from apoptosis in the focus formation assays. However, our preliminary observation that NF-
B inhibition could block the growth of Rac-transformed NIH 3T3 cells in soft agar, but not on plastic, suggests that NF-
B plays a different role for Vav versus Ras transformation.2
In contrast to JNK, the related p38 MAPK has been found to antagonize Ras transformation (52-54). Similarly, although p38 activity is stably up-regulated in Vav-transformed cells, we found that this activity is not required for Vav transformation. Whether Vav is an activator of Ras and the Raf/MEK/ERK pathway has been a subject of considerable controversy. Earlier studies by Altman and colleagues argued, rather unexpectedly, that Vav could function as a GEF for Ras (71, 72). Vav does not contain any sequences that are related to the Cdc25 homology domains required for Ras GEF activity (73, 74). Subsequently, two studies showed that Vav transformation was more consistent with its ability to activate Rho family proteins (57, 75). However, although the possibility that Vav also possessed GEF activity for Ras seemed unlikely, there remained a possibility that Vav may still cause activation of Ras by another mechanism. For example, it has been determined that the Grb2 adaptor protein can associate with the SH2 domain of Vav, providing a possible link to SOS and activation of Ras (76, 77). Raf has also been determined to interact with Vav, providing another possible mechanism for Vav activation of the Raf/MEK/ERK pathway (78). Our results showing that inhibition of MEK, by using either dominant-negative MEK or the U0126 MEK inhibitor, could effectively block Vav transformation extend our previous observations and support the involvement of such a pathway in Vav function. Furthermore, we found that inhibition of Ras impaired Vav activation of Elk-1, a downstream target of this kinase cascade, but not Vav activation of Jun. These data support a model where Vav can activate Ras and the Raf/MEK/ERK/Elk-1 pathway by a mechanism that remains to be elucidated but is distinct from how Vav activates Rho family GTPases and the JNK/Jun pathway. We and others have shown that activated Raf can cooperate with activated Rho family proteins to cause potent synergistic focus-forming activity (79). Thus, we suggest that Vav activation of a Ras-mediated pathway provides an additional explanation for the very potent transforming activity of Vav when compared with the activity seen with even coordinate expression of multiple activated Rho family proteins. However, we emphasize that these results do not support the controversial notion that Vav is a Ras GEF.
A perplexing question regarding Dbl family proteins has been that several members of this family, including Vav, exhibit focus-forming activities that cannot be mimicked by simply coexpressing activated versions of their known Rho family targets. Our studies provide two partial explanations for why Vav focus-forming activity is so potent. First, Vav caused the coordinate activation of multiple Rho family proteins, and it is possible that Vav activates additional as yet to be identified Rho family proteins. Second, Vav can weakly activate Ras and the Raf/MEK/ERK pathway. Although this activity alone does not account for Vav transformation, it may cooperate with the signals activated by Rho family GTPases to further enhance Vav transforming potential. In summary, we propose that Vav can function as a GEF to stimulate the activation of multiple Rho family proteins, together with a distinct mechanism to activate Ras, to cause potent transformation of NIH 3T3 cells via changes in gene expression. The identification of the gene targets of NF-
B, Jun, and Elk-1 important for Vav transformation constitutes an important future direction for the dissection of how Vav regulates cellular proliferation.
 |
Materials and Methods
|
|---|
Molecular Constructs
The pAX142 mammalian expression vector encoding the activated and highly transforming mouse
N-186 Vav has been described previously (19). pZIP-NeoSV(x)1 mammalian expression vectors encoding RhoA(19N), Rac1(17N), and Cdc42(17N) are dominant negatives of their respective GTPases and were described previously (29, 69). The pZIP-NeoSV(x)1 mammalian expression vector encoding p190RhoGAP (33) and the pCDNA3 mammalian expression vector encoding C3 transferase were the generous gift of J. Settleman (Massachusetts General Hospital Cancer Center and Harvard Medical School, Boston, MA). pyDF30-WASP encodes the RBD from the Cdc42-specific effector WASP (37) and was provided by M. Symons (Institute for Medical Research at North Shore-LIJ, Manhasset, NY). The construction of pAX142 plasmids encoding I
B(WT), I
B(AA), SEK1(WT), SEK1(AL), MEK1(WT), and MEK1(2A) were described previously (32). The U0126 MEK inhibitor was provided by J. Trazskos (Dupont, Wilmington, DE). Expression vectors encoding the GTP-dependent binding domains of the Rac-specific effector, Posh, or the RhoA-specific effector, Rhotekin, were generated by PCR. The GTP-bound RhoA binding domain of Rhotekin (amino acids 18-89) was amplified by PCR from a glutathione S-transferase construct containing Rhotekin-RBD (kindly provided by L. Petch, University of North Carolina at Chapel Hill). A 5' BamHI and a 3' EcoRI restriction sites were incorporated and the PCR product was subcloned into pRK5 mammalian expression vector. The cDNA sequence encoding the activated Rac-binding domain (RBD) of the Rac effector, Posh (amino acids 291-363), was constructed by oligonucleotide annealing of three complementary primer pairs (A:B, C:D, and E:F) followed by PCR of the annealed product. Briefly, oligonucleotide pairs were boiled for 5 minutes at 95°C, allowed to cool to 40°C, and mixed together and incubated at 25°C overnight. The annealed product (
230 bp) was amplified by PCR and inserted into myc-pRK5 vector using 5' BamHI and 3' EcoRI sites. Oligonucleotide sequences were the following. A: 5'-GATCCAAGCACCCCGACACCAAGAAGAACACCAGGAAGCGACACTCCTTCACCTCCCTCACCATGGCCAACAAGTCTT-3'. B: 5'-GGGACCCCTGGGAAGACTTGTTGGCCAT GGTGAGGGAGGTGAAGGAGTGTCGCTTCC TGGTGTTCTTCTTGGTGTCGGGGTGCTTG-3'. C: 5'-CCC AGGGGTCCCAGAACCGCCACTCCATGGAGATCAGCCCTCCTGTGCTCATCAGTTCCAGCAACCCCACAGCCG-3'. D: 5'-CGCTGATGCGGGCTGCGG CTGTGGGGTTGCTGGAACTGATGAGCACAGGAGGGCTGATCTCCATGGAGTGGCGGTTCT-3'. E: 5'-CAGCCCGCATCAGCGAACTGTCCGGGCTCTCCTGCAGCGCCCCGTCTCAGGTCCATATAAGCACCACTGGGATCG-3'. F: 5'-AATTCGATCCCAGTGGTGCTTATATGGACCTGAGACGGGGCGCTGCAGGAGAGCCCGGACAGTT-3'. Sequence fidelity was verified by automated DNA sequencing.
Cell Culture, Transfection, and Transformation Assays
NIH 3T3 cells were cultured in DMEM supplemented with 10% fetal calf serum. DNA transfections were done by calcium phosphate precipitation as described previously (80). For each assay, cognate empty vectors were used as controls. For focus formation analyses, transfected NIH 3T3 cells were maintained in growth medium for 12 to 14 days. The dishes were stained with crystal violet (0.5%) and the number of foci was then quantitated. The growth medium was supplemented with the U0126 MEK inhibitor at a final concentration of 30 nmol/L, the SP600125 JNK inhibitor (Biomol Research Laboratories, Inc., Plymouth Meeting, PA) at a final concentration of 10 or 20 µmol/L, or the SB203580 p38 inhibitor (Calbiochem, La Jolla, CA) at a final concentration of 5 or 10 µmol/L. Each inhibitor was added to the cells every other day for the transformation assays or immediately after glycerol shocking for the transient expression reporter gene assays. All assays were done at least three independent times.
Western Blot Analyses
To establish stable cell lines that express pCTV3 and pCTV3 encoding
N-186 Vav, transfected NIH 3T3 cells were selected in growth medium supplemented with 400 µg/mL hygromycin and multiple drugresistant colonies were pooled together after 10 days of selection to establish mass populations of stably transfected cells. For use in Western blot analysis, nearly confluent dishes of selected cells were lysed in lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 0.5% NP40, 50 mmol/L NaF, 1 mmol/L NaVO3, 1 mmol/L DTT, 10 µg/mL leupeptin, 10 µg/mL aprotinin, 1 mmol/L phenylmethylsulfonyl fluoride]. Lysates were normalized and separated by SDS-PAGE (50 µg), transferred to Immobilon-P (Millipore, Bedford, MA) membrane and incubated with the appropriate antibodies. The expression of
N-186 Vav was confirmed with an anti-hemagglutinin antibody, HA.11 (Covance, Princeton, NJ). The antibodies for JNK (#9252), phospho-JNK (#9255), p38 (#9212), and phospho-p38 (#9211) were all obtained from Cell Signaling Technology (Beverly, MA). Protein concentrations were determined with the BCA kit (Pierce, Rockford, IL) and proteins were detected by chemiluminescence (Amersham, Arlington Heights, IL).
Transient Expression Reporter Gene Assays
Transient expression transcriptional assays were done as described previously (81). Briefly, NIH 3T3 cells were transfected by calcium phosphate precipitation in six-well 30-mm dishes (5 x 105 cells per well). The cells were serum starved (0.5% calf serum) 14 to 15 hours before lysing with luciferase lysis buffer (Amersham). Lysates were analyzed using enhanced chemiluminescence reagents and a Monolight 2010 luminometer (Analytical Luminescence, Ann Arbor, MI). All the assays were done at least thrice.
The reporter plasmid constructs used for these assays have been described previously. To determine Elk-1 or c-Jun activity, we used plasmids encoding the Gal4 DNA binding domain fused to either Elk-1 or c-Jun NH2-terminal transactivation domain (Gal4-Elk-1 or Gal4-Jun, respectively) together with the 5x Gal4-Luc luciferase gene reporter plasmid where luciferase gene expression was under the control of a fos minimal promoter that contains tandem copies of the Gal4 DNA binding motif (82). The HIV NF-
B-Luc reporter has been described previously (83).
 |
Acknowledgements
|
|---|
We thank Carol Martin, Que Lambert, and Kelley Rogers-Graham for technical support.
 |
Notes
|
|---|
1 USPHS grant CA63071 (C.J. Der) and Susan G. Komen Breast Cancer Foundation fellowship (A.E. Karnoub).
Note: T.R. Palmby and K. Abe contributed equally to this work. 
3 Karnoub et al., unpublished data. 
Received August 16, 2004;
revised November 4, 2004;
accepted November 8, 2004.
 |
References
|
|---|
- Whitehead IP, Campbell S, Rossman KL, Der CJ. Dbl family proteins. Biochim Biophys Acta 1997;1332:F123.[Medline]
- Zheng Y. Dbl family guanine nucleotide exchange factors. Trends Biochem Sci 2001;26:72432.[CrossRef][Medline]
- Schmidt A, Hall A. Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev 2002;16:1587609.[Free Full Text]
- Etienne-Manneville S, Hall A. Rho GTPases in cell biology. Nature 2002;420:62935.[CrossRef][Medline]
- Wherlock M, Mellor H. The Rho GTPase family: a Racs to Wrchs story. J Cell Sci 2002;115:23940.[Free Full Text]
- Olson MF, Pasteris NG, Gorski JL, Hall A. Faciogenital dysplasia protein (FGD1) and Vav, two related proteins required for normal embryonic development, are upstream regulators of Rho GTPases. Curr Biol 1996;6:162833.[CrossRef][Medline]
- Glaven JA, Whitehead IP, Nomanbhoy T, Kay R, Cerione RA. Lfc and Lsc oncoproteins represent two new guanine nucleotide exchange factors for the Rho GTP-binding protein. J Biol Chem 1996;271:2737481.[Abstract/Free Full Text]
- Michiels F, Habets GG, Stam JC, van der Kammen RA, Collard JG. A role for Rac in Tiam1-induced membrane ruffling and invasion. Nature 1995;375:33840.[CrossRef][Medline]
- Han J, Das B, Wei W, et al. Lck regulates Vav activation of members of the Rho family of GTPases. Mol Cell Biol 1997;17:134653.[Abstract]
- Crespo P, Schuebel KE, Ostrom AA, Gutkind JS, Bustelo XR. Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature 1997;385:16972.[CrossRef][Medline]
- Abe K, Rossman KL, Liu B, et al. Vav2 is an activator of Cdc42, Rac1, and RhoA. J Biol Chem 2000;275:101419.[Abstract/Free Full Text]
- Liu BP, Burridge K. Vav2 Activates Rac1, Cdc42, and RhoA downstream from growth factor receptors but not ß1 integrins. Mol Cell Biol 2000;20:71609.[Abstract/Free Full Text]
- Zohn IM, Campbell SL, Khosravi-Far R, Rossman KL, Der CJ. Rho family proteins and Ras transformation: the RHOad less traveled gets congested. Oncogene 1998;17:141538.[CrossRef][Medline]
- Bustelo XR. Vav proteins, adaptors and cell signaling. Oncogene 2001;20:637281.[CrossRef][Medline]
- Arteaga CL. EGF receptor as a therapeutic target: patient selection and mechanisms of resistance to receptor-targeted drugs. J Clin Oncol 2003;21:28991S.[CrossRef]
- Barnes CJ, Kumar R. Biology of the epidermal growth factor receptor family. Cancer Treat Res 2004;119:113.[Medline]
- Crespo P, Bustelo XR, Aaronson DS, et al. Rac-1 dependent stimulation of the JNK/SAPK signaling pathway by Vav. Oncogene 1996;13:45560.[Medline]
- Katzav S, Martin-Zanca D, Barbacid M. vav, a novel human oncogene derived from a locus ubiquitously expressed in hematopoietic cells. EMBO J 1989;8:228390.[Medline]
- Abe K, Whitehead IP, O'Bryan JP, Der CJ. Involvement of N-terminal sequences in the negative regulation of vav signaling and transforming activity. J Biol Chem 1999;274:304108.[Abstract/Free Full Text]
- van Leeuwen FN, van der Kammen RA, Habets GGM, Collard JG. Oncogenic activity of Tiam1 and Rac1 in NIH3T3 cells. Oncogene 1995;11:221521.[Medline]
- Kawasaki Y, Senda T, Ishidate T, et al. Asef, a link between the tumor suppressor APC and G-protein signaling. Science 2000;289:11947.[Abstract/Free Full Text]
- Lamarche N, Tapon N, Stowers L, et al. Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade. Cell 1996;87:51929.[CrossRef][Medline]
- Sahai E, Alberts AS, Treisman R. RhoA effector mutants reveal distinct effector pathways for cytoskeletal reorganization, SRF activation and transformation. EMBO J 1998;17:135061.[CrossRef][Medline]
- Westwick JK, Lambert QT, Clark GJ, et al. Rac regulation of transformation, gene expression, and actin organization by multiple, PAK-independent pathways. Mol Cell Biol 1997;17:132435.[Abstract]
- Zohar M, Teramoto H, Katz BZ, Yamada KM, Gutkind JS. Effector domain mutants of Rho dissociate cytoskeletal changes from nuclear signaling and cellular transformation. Oncogene 1998;17:9918.[CrossRef][Medline]
- Katzav S, Cleveland JL, Heslop HE, Pulido D. Loss of the amino-terminal helix-loop-helix domain of the vav proto-oncogene activates its transforming potential. Mol Cell Biol 1991;11:191220.[Abstract/Free Full Text]
- Khosravi-Far R, Solski PA, Kinch MS, Burridge K, Der CJ. Activation of Rac and Rho, and mitogen activated protein kinases, are required for Ras transformation. Mol Cell Biol 1995;15:644353.[Abstract]
- Ridley AJ, Paterson HF, Johnston CL, Diekmann D, Hall A. The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 1992;70:40110.[CrossRef][Medline]
- Whitehead IP, Abe K, Gorski JL, Der CJ. CDC42 and FGD1 cause distinct signaling and transforming activities. Mol Cell Biol 1998;18:468997.[Abstract/Free Full Text]
- Feig LA. Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPase. Nat Cell Biol 1999;1:E257.[CrossRef][Medline]
- Wennerberg K, Ellerbroek SM, Liu RY, Karnoub AE, Burridge K, Der CJ. RhoG signals in parallel with Rac1 and Cdc42. J Biol Chem 2002;277:478107.[Abstract/Free Full Text]
- Whitehead IP, Lambert QT, Glaven JA, et al. Dependence of Dbl and Dbs transformation on MEK and NF-
B activation. Mol Cell Biol 1999;19:775970.[Abstract/Free Full Text]
- Settleman J, Albright CF, Foster LC, Weinberg RA. Association between GTPase activators for Rho and Ras families. Nature 1992;359:1534.[CrossRef][Medline]
- Kikuchi A, Yamamoto K, Fujita T, Takai Y. ADP-ribosylation of the bovine brain rho protein by botulinum toxin type C1. J Biol Chem 1988;263:163038.[Abstract/Free Full Text]
- Narumiya S, Sekine A, Fujiwara M. Substrate for botulinum ADP-ribosyltransferase, Gb, has an amino acid sequence homologous to a putative rho gene product. J Biol Chem 1988;263:172557.[Abstract/Free Full Text]
- Olson MF, Ashworth A, Hall A. An essential role for Rho, Rac and Cdc42 GTPases in cell cycle progression through G1. Science 1995;269:12702.[Abstract/Free Full Text]
- Symons M, Derry JMJ, Karlak B, et al. Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell 1996;84:72334.[CrossRef][Medline]
- Qiu R-G, Abo A, McCormick F, Symons M. Cdc42 regulates anchorage-independent growth and is necessary for Ras transformation. Mol Cell Biol 1997;17:344958.[Abstract]
- Nagata K, Driessens M, Lamarche N, Gorski JL, Hall A. Activation of G1 progression, JNK mitogen-activated protein kinase, and actin filament assembly by the exchange factor FGD1. J Biol Chem 1998;273:154537.[Abstract/Free Full Text]
- Cheng L, Rossman KL, Mahon GM, et al. RhoGEF specificity mutants implicate RhoA as a target for Dbs transforming activity. Mol Cell Biol 2002;22:6895905.[Abstract/Free Full Text]
- Tapon N, Nagata K, Lamarche N, Hall A. A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-
B signalling pathways. EMBO J 1998;17:1395404.[CrossRef][Medline]
- Reid T, Furuyashiki T, Ishizaki T, et al. Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophilin in the Rho-binding domain. J Biol Chem 1996;271:1355660.[Abstract/Free Full Text]
- Perona R, Montaner S, Saniger L, Sánchez-Pérez I, Bravo R, Lacal JC. Activation of the nuclear factor-
B by Rho, CDC42, and Rac-1 proteins. Genes Dev 1997;11:46375.[Abstract/Free Full Text]
- Finco TS, Westwick JK, Norris JL, Beg AA, Der CJ, Baldwin AS Jr. Oncogenic Ha-Ras-induced signaling activates NF-
B transcriptional activity, which is required for cellular transformation. J Biol Chem 1997;272:241136.[Abstract/Free Full Text]
- Mayo MW, Wang C-Y, Cogswell PC, et al. Requirement of NF-
B activation to suppress p53-independent apoptosis induced by oncogenic Ras. Science 1997;278:18125.[Abstract/Free Full Text]
- Sulciner DJ, Irani K, Yu Z-X, Ferrans VJ, Goldschmidt-Clermont P, Finkel T. Rac1 regulates a cytokine-stimulated, redox-dependent pathway necessary for NF-
B activation. Mol Cell Biol 1996;16:711521.[Abstract]
- DiDonato J, Mercurio F, Rosette C, et al. Mapping of the inducible I
B phosphorylation sites that signal its ubiquitination and degradation. Mol Cell Biol 1996;16:1295304.[Abstract]
- Minden A, Lin A, Claret F-X, Abo A, Karin M. Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell 1995;81:114757.[CrossRef][Medline]
- Coso OA, Chiariello M, Yu J-C, et al. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway. Cell 1995;81:113746.[CrossRef][Medline]
- Raingeaud J, Gupta S, Rogers JS, et al. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation of tyrosine and threonine. J Biol Chem 1995;270:74206.[Abstract/Free Full Text]
- Kyriakis J, Avruch J. Protein kinase cascades activated by stress and inflammatory cytokines. BioEssays 1996;18:56777.[CrossRef][Medline]
- Pruitt K, Pruitt WM, Bilter GK, Westwick JK, Der CJ. Raf-independent deregulation of p38 and JNK mitogen-activated protein kinases are critical for Ras transformation. J Biol Chem 2002;277:3180817.[Abstract/Free Full Text]
- Ellinger-Ziegelbauer H, Kelly K, Siebenlist U. Cell cycle arrest and reversion of Ras-induced transformation by a conditionally activated form of mitogen-activated protein kinase kinase kinase 3. Mol Cell Biol 1999;19:385768.[Abstract/Free Full Text]
- Chen G, Hitomi M, Han J, Stacey DW. The p38 pathway provides negative feedback for Ras proliferative signaling. J Biol Chem 2000;275:3897380.[Abstract/Free Full Text]
- Sanchez I, Hughes RT, Mayer BJ, et al. Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature 1994;372:794.[Medline]
- Bennett BL, Sasaki DT, Murray BW, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 2001;98:136816.[Abstract/Free Full Text]
- Khosravi-Far R, Chrzanowska-Wodnicka M, Solski PA, Eva A, Burridge K, Der CJ. Vav and Dbl mediate transformation via Ras-independent mitogen activated protein kinase activation. Mol Cell Biol 1994;14:684857.[Abstract/Free Full Text]
- Qiu R-G, Chen J, Kirn D, McCormick F, Symons M. An essential role for Rac in Ras transformation. Nature 1995;374:4579.[CrossRef][Medline]
- Qiu R-G, Chen J, McCormick F, Symons M. A role for Rho in Ras transformation. Proc Natl Acad Sci U S A 1995;92:117815.[Abstract/Free Full Text]
- Mansour SJ, Matten WT, Hermann AS, et al. Transformation of mammalian cells by constitutively active MAP kinase kinase. Science 1994;265:96670.[Abstract/Free Full Text]
- Cowley S, Paterson H, Kemp P, Marshall CJ. Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 1994;77:84152.[CrossRef][Medline]
- DeSilva DR, Jones EA, Favata MF, et al. Inhibition of mitogen-activated protein kinase kinase blocks T cell proliferation but does not induce or prevent anergy. J Immunol 1998;417581.
- Favata MF, Horiuchi KY, Manos EJ, et al. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 1998;273:1862332.[Abstract/Free Full Text]
- Treisman R. Regulation of transcription by MAP kinase cascades. Curr Opin Cell Biol 1996;8:20515.[CrossRef][Medline]
- Whitmarsh AJ, Shore P, Sharrocks AD, Davis RJ. Integration of MAP kinase signal transduction pathways at the serum response element. Science 1995;269:4037.[Abstract/Free Full Text]
- Frost JA, Xu S, Hutchison MR, Marcus S, Cobb MH. Actions of Rho family small G proteins and p21-activated protein kinases on mitogen-activated protein kinase family members. Mol Cell Biol 1996;16:370713.[Abstract]
- Roux P, Gauthier-Rouvière C, Doucet-Brutin S, Fort P. The small GTPases Cdc42Hs, Rac1 and RhoG delineate Raf-independent pathways that cooperate to transform NIH3T3 cells. Curr Biol 1997;7:62937.[CrossRef][Medline]
- Lin R, Cerione RA, Manor D. Specific contributions of the small GTPases Rho, Rac, and Cdc42 to Dbl transformation. J Biol Chem 1999;274:2363341.[Abstract/Free Full Text]
- Khosravi-Far R, White MA, Westwick JK, et al. Oncogenic Ras activation of Raf/MAP kinase-independent pathways is sufficient to cause tumorigenic transformation. Mol Cell Biol 1996;16:392333.[Abstract]
- Clark GJ, Westwick JK, Der CJ. p120 GAP modulates Ras activation of Jun kinases and transformation. J Biol Chem 1997;272:167781.[Abstract/Free Full Text]
- Gulbins E, Coggeshall KM, Baier G, Katzav S, Burn P, Altman A. Tyrosine kinase-stimulated guanine nucleotide exchange activity of Vav in T cell activation. Science 1993;260:8225.[Abstract/Free Full Text]
- Gulbins E, Coggeshall KM, Langlet C, et al. Activation of Ras in vitro and in intact fibroblasts by the Vav guanine nucleotide exchange protein. Mol Cell Biol 1994;14:90613.[Abstract/Free Full Text]
- Ebinu JO, Bottorff DA, Chan EY, Stang SL, Dunn RJ, Stone JC. RasGRP, a Ras guanyl nucleotide-releasing protein with calcium- and diacylglycerol-binding motifs. Science 1998;280:10826.[Abstract/Free Full Text]
- Quilliam LA, Rebhun JF, Castro AF. A growing family of guanine nucleotide exchange factors is responsible for activation of Ras-family GTPases. Prog Nucleic Acid Res Mol Biol 2002;71:391444.[Medline]
- Bustelo XR, Suen KR, Leftheris K, Meyers CA, Barbacid M. Vav cooperates with Ras to transform rodent fibroblasts but is not a Ras GDP/GTP exchange factor. Oncogene 1994;9:240513.[Medline]
- Ye ZS, Baltimore D. Binding of Vav to Grb2 through dimerization of Src homology 3 domains. Proc Natl Acad Sci U S A 1994;91:1262933.[Abstract/Free Full Text]
- Ramos-Morales F, Romero F, Schweighoffer F, et al. The proline-rich region of Vav binds to Grb2 and Grb3-3. Oncogene 1995;11:16659.[Medline]
- Song JS, Gomez J, Stancato LF, Rivera J. Association of a p95 Vav-containing signaling complex with the FceRI G chain in the RBL-2H3 mast cell line. J Biol Chem 1996;271:2696270.[Abstract/Free Full Text]
- Solski PA, Abe K, Der CJ. Analyses of transforming activity of Rho family activators. Methods Enzymol 2000;325:42541.[Medline]
- Clark GJ, Cox AD, Graham SM, Der CJ. Biological assays for Ras transformation. Methods Enzymol 1995;255:395412.[Medline]
- Hauser CA, Westwick JK, Quilliam LA. Ras-mediated transcription activation: analysis by transient cotransfection assays. Methods Enzymol 1995;255:41226.[Medline]
- Su B, Jacinto E, Hibi M, Kallunki T, Karin M, Ben-Neriah Y. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 1994;77:72736.[CrossRef][Medline]
- Zohn IE, Symons M, Chrzanowska-Wodnicka M, Westwick JK, Der CJ. Mas oncogene signaling and transformation require the small GTP-binding protein Rac. Mol Cell Biol 1998;18:122535.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. Watanabe, M. Tsuda, Y. Makino, S. Ichihara, H. Sawa, A. Minami, N. Mochizuki, K. Nagashima, and S. Tanaka
Adaptor Molecule Crk Is Required for Sustained Phosphorylation of Grb2-Associated Binder 1 and Hepatocyte Growth Factor-Induced Cell Motility of Human Synovial Sarcoma Cell Lines
Mol. Cancer Res.,
July 1, 2006;
4(7):
499 - 510.
[Abstract]
[Full Text]
[PDF]
|
 |
|