Molecular Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Chemical and Biological Aspects of Inflammation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwarz, J. K.
Right arrow Articles by Piwnica-Worms, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwarz, J. K.
Right arrow Articles by Piwnica-Worms, H.
Molecular Cancer Research 1:598-609 (2003)
© 2003 American Association for Cancer Research

DNA Damage and Cellular Stress Responses

Regulation of the Chk2 Protein Kinase by Oligomerization-Mediated cis- and trans-Phosphorylation1

Julie K. Schwarz1, Christine M. Lovly1 and Helen Piwnica-Worms1,2,3

Departments of 1 Cell Biology and Physiology and 2 Internal Medicine, Washington University School of Medicine, St. Louis, MO; and 3 Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO

Requests for reprints: Christine M. Lovly, Department of Cell Biology and Physiology, Washington University School of Medicine, 660 South Euclid Avenue, Box 8228, St. Louis, MO 63110. Phone: (314) 362-6834; Fax: (314) 362-3709. E-mail: lovlyc{at}msnotes.wustl.edu


   Abstract
Top
 Notes
 Abstract
Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Chk2 is a serine/threonine protein kinase found mutated in certain hereditary and sporadic cancers. Ionizing radiation (IR) activates the kinase activity of Chk2 in a phosphorylation-dependent manner. ATM phosphorylates Chk2 on threonine 68, which promotes oligomerization and phosphorylation on threonines 383 and 387 within the activation loop of the catalytic domain. In this study, threonines 68, 383, and 387 were confirmed as sites of Chk2 phosphorylation both in vitro and in vivo. In addition, serine 516 was identified as a novel IR-inducible phosphorylation site in vivo and as a site of autophosphorylation in vitro. Interestingly, Chk2 was capable of autoactivation in the absence of IR when overproduced in bacteria, in 293 cells, and in murine embryonic fibroblasts lacking Chk2. A kinase-inactive mutant of Chk2 was phosphorylated on T68 and T383/T387 but not on S516 in cells containing Chk2 and on T68 but not T383/T387 or S516 in cells lacking Chk2. This establishes a dependency on Chk2 kinase activity for phosphorylation of T383/T387 and S516 but not for T68 in vivo. We demonstrate that T68 phosphorylation is regulated by kinases in addition to ATM and Chk2. Taken together, our data indicate that autophosphorylation of Chk2 can occur both in cis and in trans and suggest that oligomerization may regulate Chk2 activation by promoting these cis- and trans-phosphorylation events. The importance of oligomerization is underscored by the observation that substitution of isoleucine for threonine at position 157, a mutation found in a subset of patients with Li-Fraumeni syndrome, impairs both Chk2 oligomerization and autophosphorylation.

Key Words: Chk2 • Checkpoints • DNA damage • Li-Fraumeni syndrome • p53


   Introduction
Top
 Notes
 Abstract
 Introduction
Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
The integrity of chromosomal DNA is under constant surveillance throughout the cell division cycle. DNA damage activates signal transduction pathways called checkpoints, and checkpoints ultimately interface with cell cycle regulators to prevent cell cycle progression in the presence of damaged genetic material. Defects in checkpoints can result in genomic instability and cancer predisposition (1). The phosphoinositide (PI)-3-like protein kinases ATM (ataxia telangiectasia mutated) and ATR (ATM and Rad3 related) play critical roles in transducing DNA damage signals (2, 3). The ATM gene is mutated in patients with the genetic disorder ataxia telangiectasia (AT), a heritable cancer predisposition syndrome (4). Cells derived from AT patients are defective in the ionizing radiation (IR)-induced G1-, S-, and G2-phase checkpoints and AT cells exhibit chromosomal instability and hypersensitivity to genotoxic agents (5).

A number of studies have focused on defining downstream effectors of ATM that are important for propagating the DNA damage signal. In response to IR, functional ATM is required for activation of Chk2 (6–9). Chk2, the human homologue of the checkpoint kinases Cds1 (Schizosaccharomyces pombe) and Rad53 (Saccharomyces cerevisiae), is a serine/threonine-protein kinase that is phosphorylated and activated in response to IR and to a lesser extent by hydroxyurea treatment. Chk2 kinase activation is required for IR-induced phosphorylation of the p53 tumor suppressor on serine 20. Ectopic expression of wild-type but not catalytically inactive Chk2 leads to enhanced p53 stabilization and G1 arrest after DNA damage in U2OS cells (10). Consistent with these results, cells derived from Chk2-deficient mice demonstrate significant defects in both the IR-induced G1-phase checkpoint and p53-dependent apoptosis (11, 12). Moreover, heterozygous germ line mutations in the Chk2 gene have been associated with a p53-independent variant form of Li-Fraumeni syndrome, a heritable cancer predisposition syndrome characterized by early onset of leukemia and lymphoma, as well as tumors of the breast, brain, and adrenal cortex (13).

While much of the current work on Chk2 has focused on understanding how Chk2 propagates DNA damage signals, less is known about how Chk2 itself is activated in response to DNA damage. Several groups have reported that ATM can directly phosphorylate Chk2 in vitro on threonine 68 (T68) (14–17). In vivo, phosphorylation of T68 is IR-inducible and requires ATM. Phosphorylation of T68 has been linked to activation of Chk2 kinase activity after IR because the T68A mutant of Chk2 fails to become fully activated in response to IR. T68 phosphorylation, however, is not the sole requirement for activation of Chk2, as the T68A mutation does not completely abolish IR-induced increases in Chk2 activity (14). More recently, T68 has been proposed to function as a trigger for a cascade of Chk2 phosphorylation events that includes phosphorylation of threonines 383 and 387, two conserved residues located within the activation loop of the Chk2 kinase domain (18).

T68 lies in the SQ/TQ cluster domain of Chk2. Distal to the SQ/TQ cluster domain, Chk2 contains a forkhead-associated (FHA) domain, which may also play a role in Chk2 activation and regulation post IR. FHA domains function as phospho-threonine (pT)-binding protein-protein interaction motifs. Structures of the Chk2 FHA domain and the RAD53 FHA2 domain complexed with bound pT-containing peptides have been solved (19–21). Heritable mutations in the FHA domain of Chk2 associated with Li-Fraumeni syndrome occur within ß strands that do not contact bound pT-containing peptides (13, 21). This region has been proposed to contribute binding surfaces for the interactions between Chk2 and its target substrates (21). The FHA domain of Chk2 has also been proposed to mediate Chk2 oligomerization via direct interaction with Chk2 molecules that are phosphorylated on threonine residues, including T68 (21–23). However, there are discrepancies regarding the absolute requirement of T68 phosphorylation for oligomerization and regarding the contribution made by Chk2 kinase activity to the stability of Chk2 oligomers.

In this study, the phosphorylation and activation of human Chk2 was examined both in vitro and in vivo. Chk2 was capable of autoactivation when it was overproduced in bacteria or in mammalian tissue culture cells in the absence of IR. Autoactivation was consistent with the phosphorylation of Chk2 on T68, T383/T387, and on S516—a novel phosphorylation site identified in this study. Furthermore, autoactivation was coincident with oligomerization of Chk2 molecules in mammalian tissue culture cells. Taken together, these results suggest that oligomerization can promote phosphorylation and autoactivation of Chk2 in the absence of IR and ATM activity.


   Results
Top
 Notes
 Abstract
 Introduction
 Results
Discussion
 Materials and Methods
 Acknowledgements
 References
 
Phosphorylation of Chk2 in Vitro and in Vivo
Two-dimensional phosphopeptide mapping was performed to determine the phosphorylation pattern of Chk2 both in vivo and in vitro. HeLa cells treated with etoposide (VP16), a topoisomerase II inhibitor, to induce double-stranded DNA breaks were incubated with 32P-labeled inorganic phosphate, and endogenous Chk2 was isolated by immunoprecipitation (Fig. 1A). In addition, 293 cells transfected with plasmids encoding wild-type and mutant forms of Flag-tagged Chk2 (Fig. 1, D–G) were incubated with 32P-labeled inorganic phosphate in the presence of etoposide. Three predominant phosphopeptides (denoted 1, 2, and 3a) were evident in the case of both endogenous (Fig. 1A) and ectopically produced (Fig. 1D) Chk2. The pattern of phosphorylation observed when kinase assays were performed in vitro with bacterially produced Chk2 (Fig. 1B) was remarkably similar to that observed when endogenous Chk2 was labeled in vivo (Fig. 1A). Mixing experiments (Fig. 1C) revealed the presence of phosphopeptides 1, 2, and 3a and in addition, a new phosphopeptide designated 3b seen in vitro but not in vivo. Phosphoamino acid analysis demonstrated that phosphopeptides 2 and 3a contained phosphoserine and phosphopeptides 1 and 3b contained pT (data not shown). Interestingly, phosphopeptide 1 but not 2 or 3a was observed when 32P-labeled kinase-inactive Chk2 was subjected to two-dimensional phosphopeptide mapping (Fig. 1E). These results demonstrate that phosphopeptides 2, 3a, and 3b but not 1 require the kinase activity of Chk2. Mutation of T68 resulted in partial loss of phosphopeptide 1, whereas mutation of serine 516 resulted in a complete loss of phosphopeptide 2 (Fig. 1G). Taken together, these results suggest that phosphorylation of S516 but not T68 requires the kinase activity of Chk2. Chk2 is also phosphorylated within the activation loop of its kinase domain on threonines 383 and 387 (18). Peptides containing pT383/T387 were not detected when Chk2 was digested with chymotrypsin.



View larger version (68K):
[in this window]
[in a new window]
  		FIGURE 1. Phosphorylation of Chk2 in vitro and in vivo. Asynchronously growing HeLa cells or 293 cells expressing Flag-tagged Chk2 proteins (WT, D368N, T68A, and S516A) were incubated with 32P-labeled inorganic phosphate in the presence of 25 µM VP-16. Radiolabeled endogenous (panel A) and ectopically produced (panels D–G) Chk2 proteins were digested with chymotrypsin and peptides were subjected to two-dimensional phosphopeptide mapping. Bacterially produced recombinant GST-Chk2 protein was phosphorylated in vitro in the presence of {gamma}-32P-ATP and analyzed as described above (panel B). Panel C is a mixture of the chymotryptic peptides loaded in panels A and B. Arrows within the phosphopeptide maps represent the absence of a given phosphopeptide on the corresponding map relative to the Chk2 WT map.

 
Phosphorylation and Auto-Activation of Bacterially Produced Chk2
Increases in local concentration of Rad53 have been proposed to activate Rad53 kinase activity by promoting trans-phosphorylation (24). To determine if Chk2 behaved similarly, kinase-active and -inactive forms of Chk2 were overproduced in bacteria and phosphorylation status was monitored as a function of time using phospho-specific antibodies developed for these studies (Fig. 2D). Phosphorylation sites examined included T68, T383/T387, and S516. As shown in Fig. 2A, a shift in the electrophoretic mobility of Chk2 was observed at 120 min post induction (lane 8). This shift in mobility was due to phosphorylation, because treatment of Chk2 with {lambda} phosphatase increased its electrophoretic mobility (Fig. 2B). As seen in panel 2A (left panel), phosphorylation of T68, S516, and T383/T387 occurred in a time-dependent manner being first detected at 30 min post induction. The timing of one phosphorylation site relative to another cannot be assessed due to differences in the affinity between each phospho-specific antibody for its relevant epitope. Kinase-inactive Chk2 was not phosphorylated on T68, S516, or T383/T387 and its electrophoretic mobility did not change with time (Fig. 2A, right panel). Thus, both the phosphorylation and electrophoretic mobility shift of Chk2 required Chk2 kinase activity in this assay. In addition, a correlation between Chk2 phosphorylation and enhanced Chk2 kinase activity was observed demonstrating that phosphorylation positively regulates Chk2 kinase activity (Fig. 2C). The phosphorylation of recombinant Chk2 observed in vitro could be due to either trans-phosphorylation (intermolecular between two Chk2 molecules) or autophosphorylation (intramolecular within a single Chk2 molecule) mechanisms. As seen in Fig. 2E, kinase-active Chk2 phosphorylated kinase-inactive Chk2 on T68 (lane 6), T383/T387 (lane 9), and S516 (lane 12). Thus, phosphorylation of Chk2 on T68, T383/T387, and S516 can occur in trans in the absence of ATM. However, in these reactions, the kinase-inactive substrate was present at higher levels than the wild-type Chk2 enzyme (lane 3). Interestingly, individual sites appear to show some preference for auto- versus trans-phosphorylation. WT Chk2 favored phosphorylation of T383/T387 in trans on the kinase-inactive mutant (lane 9). In contrast, WT Chk2 preferred to autophosphorylate (in cis) on T68 and S516 rather than to trans-phosphorylate the kinase-inactive mutant on these sites (lanes 6 and 12).



View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 2. Phosphorylation and activation of Chk2 in bacteria. A. Escherichia coli transformed with plasmids encoding His6-Chk2(WT) or His6-Chk2(D368N) were induced to express Chk2 for the indicated times. His-tagged Chk2 from these samples was purified and quantitated. Matched amounts of protein from each time point were resolved by SDS-PAGE and blotted with indicated antibodies. B. Recombinant Chk2 was incubated in the absence or presence of {lambda}-phosphatase. Reactions were resolved by SDS-PAGE and immunoblotted for Chk2. C. Samples from A were subjected to kinase assays in vitro in the presence of ({gamma}-32P)-ATP using purified GST-Cdc25C(200–256) as a substrate. Incorporated counts were quantified by scintillation counting. Points, mean values for triplicate kinase assays performed for each mutant; error bars, SD. D. 293 cells expressing Flag-tagged Chk2 WT or phosphorylation site mutants were immunoprecipitated with an antibody specific for the flag epitope. Immunoprecipitates were resolved by SDS-PAGE and blotted with phospho-specific antibodies indicated. The blots were stripped and re-probed with an antibody specific for the flag epitope. E. Kinase assays were carried out in vitro in the presence of GST-Chk2(WT) and His6-Chk2(D368N). Reactions were resolved by SDS-PAGE and Western blotted with the indicated antibodies.

 
IR Induces the Phosphorylation and Turnover of Chk2 in Vivo
An antibody specific for Chk2 phosphorylated on S516 was used to monitor the phosphorylation status of endogenous Chk2 following IR. As seen in Fig. 3A, a slower migrating form of Chk2 was visible at the earliest time point (30 min, anti-Chk2 blot). The slower electrophoretic form of Chk2 persisted for the duration of the experiment (2 h) but overall levels of Chk2 declined over the course of the experiment. Chk2 was inducibly phosphorylated on T68, T383/T387, and S516 by 30 min post IR (lane 2). The reactivity of pT68, pS516, and pT383/T387 paralleled Chk2 protein levels and all declined over the course of the experiment.



View larger version (71K):
[in this window]
[in a new window]
  		FIGURE 3. IR induces the phosphorylation and turnover of Chk2 in vivo. A. Endogenous Chk2 was immunoprecipitated from HeLa cells that had been mock-irradiated (lane 1) or exposed to 10 Gy IR at the indicated times (lanes 2–4). Immunoprecipitates were resolved by SDS-PAGE and blotted with the indicated antibodies. B. Endogenous Chk2 was immunoprecipitated from HeLa cells that had been mock-irradiated (lanes 1 and 2) or exposed to 10 Gy IR (lanes 3 and 4) using the anti-pS516 antibody (IP). Supernatants (S) from the pS516-immunoprecipitates were then immunoprecipitated with anti-Chk2 antibody. Immunoprecipitates were resolved by SDS-PAGE and blotted with the indicated antibodies. C. Flag-tagged Chk2 proteins (WT and mutants) were immunoprecipitated from HeLa cells that had been mock-irradiated (lanes 1, 5, 9, and 13) or exposed to 10 Gy IR. Immunoprecipitates were resolved by SDS-PAGE and blotted with the indicated antibodies. D. HeLa cells, expressing Flag-tagged Chk2, were treated with 25 µg/ml cycloheximide for 1 h before being mock-irradiated (lanes 1–5) or irradiated with 10 Gy {gamma}-IR (lanes 6–10). Lysates were prepared at the indicated times, resolved by SDS-PAGE, and Chk2 levels were monitored by Western blotting using a monoclonal antibody specific for Chk2.

 
Next, immunoprecipitation experiments were performed to determine the stoichiometry of S516 phosphorylation after IR. Cells that had been mock- or {gamma}-irradiated were lysed and lysates were incubated with the anti-pS516 antibody. Chk2 protein levels were monitored in the immunoprecipitate (IP) and post-immunoprecipitate supernatant (S) by immunoblotting. As seen in Fig. 3B (lane 3), the anti-pS516 antibody completely cleared Chk2 from the supernatant (compare lanes 3 and 4, anti-Chk2 blot). This indicates that Chk2 becomes stoichiometrically phosphorylated on S516 by 30 min post IR. Reactivity of S516-phosphorylated Chk2 with both the pT68 and pT383/T387 antibodies was also observed. As expected, Chk2 was not immunoprecipitated by the anti-pS516 antibody from mock-irradiated lysates (lanes 1 and 2).

Next, wild-type and mutant forms of Chk2 were expressed in cells to determine which phosphorylation sites required the kinase activity of Chk2 and to determine whether there was an interdependence between individual phosphorylation sites (Fig. 3C). Cells expressing wild-type and mutant forms of Chk2 were mock- or {gamma}-irradiated and the phosphorylation status of ectopic Chk2 was monitored as a function of time using phospho-specific antibodies. As seen in Fig. 3C, ectopically expressed Chk2 behaved like endogenous Chk2 (Fig. 3A). A slower migrating form of Chk2 was visible 30 min after exposure of cells to IR (anti-flag blot). The slower electrophoretic forms of Chk2 persisted for the duration of the experiment and overall levels of Chk2 declined over the 2-h time period. Chk2 was inducibly phosphorylated on T68, S516, and T383/T387 at 30 min post IR (lane 2) and the phosphorylation of Chk2 on each site paralleled Chk2 protein levels. Kinase-inactive Chk2 (D368N) was inducibly phosphorylated on T68 and T383/T387 after IR (lane 6). In contrast, kinase-inactive Chk2 did not become phosphorylated on S516 following IR, indicating that phosphorylation of S516, but not T68 or T383/T387, absolutely requires the kinase activity of Chk2. Notably, Chk2-T68A was inducibly phosphorylated on T383/T387 and S516 after IR (lane 10), although the kinetics of phosphorylation was delayed relative to wild type (lane 2). Chk2-S516A was inducibly phosphorylated on T68 and T383/T387 after IR (lane 14) with kinetics similar to wild type. Taken together, these data demonstrate that S516 phosphorylation requires the kinase activity of Chk2. In addition, T68 phosphorylation is not required for phosphorylation of T383/T387 and S516 after IR, although it may accelerate the rate of phosphorylation of these sites. Finally, the abundance of Chk2 was monitored by Western blotting following irradiation (Fig. 3D). Cycloheximide was included to block protein synthesis. Levels of both ectopic and endogenous Chk2 declined in a time-dependent manner following IR (lanes 7–10). In contrast, levels of ectopic and endogenous Chk2 remained unchanged for up to 3 h in mock-irradiated samples (lanes 2–5).

Serine 516 Phosphorylation Does Not Regulate the Kinase Activity of Chk2
It has previously been shown that phosphorylation of T383/387 is required for Chk2 kinase activity (18) and that phosphorylation of T68 is required for full activation of Chk2 following IR (14–17). To determine the contribution made by S516 phosphorylation to Chk2 kinase activity, we monitored the effect of mutation of serine 516 to alanine on the kinase activity of Chk2 both before and after irradiation (Fig. 4). As seen in Fig. 4A, the electrophoretic mobility of Chk2 S516A (lane 10), like Chk2 WT (lane 1), was retarded in response to IR. In contrast, the electrophoretic mobilities of only a small fraction of Chk2 T68A (lane 8) and of Chk2 T68A/S516A (lane 12) were retarded following IR and the mobilities of Chk2 D368N (lane 4) and of Chk2 T383A/T387A (lane 6) were not altered by IR. The kinase activity of Chk2 was significantly impaired by mutation of T383/T387 (Fig. 4C). In contrast, the kinase activity of Chk2 S516A was not significantly different from that of wild-type Chk2 in either the absence or presence of IR (Fig. 4B). Thus, phosphorylation of Chk2 on S516 following IR does not appear to regulate the kinase activity of Chk2.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 4. S516 phosphorylation does not regulate the kinase activity of Chk2. A. Flag-tagged Chk2 proteins (WT and mutants) were immunoprecipitated from HeLa cells that had been mock-irradiated (-) or from HeLa cells 30 min after exposure to 10 Gy IR (+). Protein levels from each sample were matched and Chk2 proteins were tested for their ability to phosphorylate GST-Cdc25C(200–256) in vitro. 32P-labeled GST-Cdc25C(200–256) was quantified using a phosphorimager. Reactions were done in duplicate (B) or triplicate (C) and SD is shown as error bars along the Y axis.

 
Oligomerization and Autoactivation of Ectopic Chk2 in Vivo
Chk2 has been reported to oligomerize in a phosphorylation-dependent manner following IR treatment (22, 23). We predicted that if Chk2 was overproduced to sufficient levels in vivo, it should be able to oligomerize and autoactivate in the absence of IR. We found that wild-type Chk2 oligomerizes in an IR-independent manner when it is ectopically produced in 293 cells. As seen in Fig. 5A, co-immunoprecipitation of Flag- and Myc-tagged Chk2 molecules was observed when they were co-produced in 293 cells (lane 4). Given the ability of Chk2 to undergo cis- and trans-phosphorylation reactions, it was predicted that Chk2 would also be phosphorylated on T68 and S516 in the absence of IR in 293 cells. This was indeed the case. As seen in Fig. 5B, wild-type Chk2 was phosphorylated on T68 and S516 in an IR-independent manner in 293 cells (lane 1). Similarly, kinase-inactive Chk2 (D368N) was phosphorylated on T68 (lane 2), the T68A mutant was phosphorylated on S516 (lane 3), and the S516A mutant was phosphorylated on T68 (lane 4). The phosphorylation of the Chk2 proteins in 293 cells was insensitive to caffeine, indicating that phosphorylation of T68 was independent of ATM activity (data not shown). To test this directly, wild-type and kinase-inactive Chk2 proteins were overproduced in AT cells (25) and monitored for phosphorylation. As seen in Fig. 5C, both proteins were phosphorylated on T68 in the absence of ATM and in the absence of IR in AT cells.



View larger version (59K):
[in this window]
[in a new window]
  		FIGURE 5. T68 phosphorylation is regulated by kinases in addition to ATM and Chk2. A. 293 cells were mock transfected (lanes 1 and 5) or transfected with plasmids encoding either Myc-tagged Chk2 (lanes 2 and 4), Flag-tagged Chk2 (lanes 3 and 4), or both (lane 4). Lysates were incubated with antibodies specific for Flag or Myc and immunoprecipitates (IP) were resolved by SDS-PAGE and immunoblotted (IB) with the indicated antibodies. B. Lysates from 293 cells overproducing Flag-tagged Chk2 (WT and mutants) were incubated with antibodies specific for the Flag-tag and precipitates were resolved by SDS-PAGE and immunoblotted with the indicated antibodies. C. AT cells were infected with recombinant adenoviruses expressing either Chk2 WT or Chk2 D368N. Recombinant Chk2 proteins were immunoprecipitated, resolved by SDS-PAGE, and immunoblotted (IB) with the indicated antibodies. D. Flag-tagged Chk2 D368N was immunoprecipitated from Chk2-/- MEFs that had been mock-irradiated (lane 1) or exposed to 10 Gy IR (lane 2). Immunoprecipitates were resolved by SDS-PAGE and blotted with the indicated antibodies.

 
Phosphorylation of the kinase-inactive mutant of Chk2 (Chk2 D368N) on T68 in the absence of DNA damage (Fig. 5, B and C) and on T383/T387 (Fig. 3C) may result from trans-phosphorylation by endogenous Chk2. To test this hypothesis, MEFs derived from Chk2 knockout mice were transfected with kinase-inactive Chk2 and either mock- or {gamma}-irradiated. The phosphorylation status of ectopic Chk2 D368N was monitored using phospho-specific antibodies. As seen in Fig. 5D, Chk2 D368N was phosphorylated on T68 in the absence of IR (lane 1) and as expected levels of T68 phosphorylation rose following IR (lane 2). Importantly, Chk2 D368N was not phosphorylated on T383/T387 in Chk2-/- cells, suggesting that the phosphorylation observed following IR in HeLa cells (Fig. 3C, lanes 6–8) is due to phosphorylation by endogenous Chk2 in trans. Consistent with data shown in Figs. 3C and 5B, Chk2 D368N was not phosphorylated on S516.

Chk2 (I157T) Is Impaired in Its Ability to Oligomerize
Two Chk2 FHA domain mutations have been reported in patients with Li-Fraumeni syndrome (13). One of these mutations (R145W) impairs the kinase activity of Chk2 (18, 21, 26). A second mutant form of Chk2 containing threonine in place of isoleucine at position 157 has normal kinase activity, is phosphorylated on T68 following IR, and its FHA domain binds normally to pThr-containing phosphopeptides (21, 26). To decipher the defect associated with this mutant, we overproduced Chk2 I157T in Chk2-/- MEFs and compared its behavior to wild-type Chk2 (Fig. 6). As shown previously, there is a direct correlation between the Chk2 kinase activity, Chk2 phosphorylation, and mobility shifts on SDS gels (Figs. 2 and 5). Given that the I157T mutant was fully active as a protein kinase, we expected this mutant to undergo autophosphorylation and to migrate more slowly on SDS gels to the same extent as wild-type Chk2. The electrophoretic mobility of Chk2 I157T was retarded when it was overexpressed but the fraction of Chk2 I157T that exhibited this altered mobility was significantly reduced compared with wild-type Chk2 (Fig. 6A, lane 2, lower two panels). Interestingly, mutation of isoleucine 157 severely impaired the ability of Chk2 to associate with other Chk2 molecules (Fig. 6A, lane 2, upper two panels). In addition, Chk2 I157T was not efficiently phosphorylated on T68, T383/T387, or S516 (Fig. 6B, lane 2). Failure of Chk2 I157T to efficiently oligomerize likely accounts for the reduced autophosphorylation observed when it is overproduced in Chk2-/- MEFs. Similar observations were made in 293 cells (data not shown).



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 6. The FHA domain mutation I157T impairs Chk2 oligomerization. A. Chk2-/- MEFs were transfected with plasmids encoding Flag-tagged Chk2 WT and Myc-tagged Chk2 WT (lane 1) or Flag-tagged Chk2 I157T and Myc-tagged Chk2 I157T (lane 2). Lysates were incubated with antibodies specific for the Flag or Myc epitopes. Immunoprecipitates (IP) were resolved by SDS-PAGE and immunoblotted (IB) with the indicated antibodies. B. Chk2-/- MEF lysates from A were incubated with an antibody specific for the Flag epitope. Immunoprecipitates were blotted with the indicated antibodies.

 

   Discussion
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
Materials and Methods
 Acknowledgements
 References
 
IR affects Chk2 in multiple ways. It induces Chk2 phosphorylation and activation (6–9, 14–17); it induces Chk2 oligomerization (22, 23); and it appears to promote the degradation of Chk2 (Fig. 3, A, C, and D). It is controversial as to whether IR induces the relocation of Chk2 to sites of DNA strand breaks (27, 28). In this study, the phosphorylation of Chk2 was examined both in vitro and in vivo and the dependency of Chk2 activation on IR treatment was investigated.

Although Chk2 oligomerization is reportedly induced by DNA damage signals in vivo, we observed significant oligomerization of Chk2 in Chk2-/- MEFs and in 293 cells in the absence of IR. This is likely due to the high levels of Chk2 protein produced in these cells. Similarly, we observed autoactivation of Chk2 kinase activity in bacteria in a time- and phosphorylation-dependent manner as the concentration of Chk2 increased. Thus, overexpression of Chk2 promotes auto- and trans-phosphorylation events that in turn result in activation of Chk2 in the absence of IR. We observed significant phosphorylation, oligomerization, and activation of Chk2 kinase activity by simply increasing the concentration of Chk2. Similarly, in budding yeast, increases in local concentration have been proposed to promote Rad53 phosphorylation and activation in response to checkpoints. In this organism, Rad53 local concentration is regulated by binding to the Rad9 scaffolding protein. Phosphorylation of Rad9 by Mec1/Tel1 has been proposed to promote binding of multiple Rad53 molecules via interactions between phosphorylated threonine residues in Rad9 and the FHA domain of Rad53. Bound Rad53 molecules undergo trans-phosphorylation, activation, and are subsequently released from the Rad9 complex to phosphorylate downstream targets. Although a human equivalent to the Rad9 scaffolding protein has not been identified, it is possible that a similar mechanism operates to activate Chk2. In this case, however, a scaffolding protein may not be required. Phosphorylated Chk2 is capable of directly binding an inactive Chk2 molecule via interactions between phosphorylated residues in the amino terminus of activated Chk2 and the FHA domain of the inactive Chk2 molecule. Because Chk2 can oligomerize and autoactivate, it becomes even more important to understand how local Chk2 concentration is regulated before and after IR in vivo.

A subset of patients with Li-Fraumeni syndrome contains mutations in the FHA domain of Chk2 (13). One of these mutations substitutes threonine for isoleucine at position 157. The I157T mutant has normal kinase activity, is phosphorylated on T68 following IR, and its FHA domain binds normally to pThr-containing phosphopeptides (21, 26). Li et al. (21) reported that Chk2 I157T does not bind to target substrates as efficiently as wild-type Chk2. In this study, we demonstrate that the I157T mutant is severely impaired in its ability to oligomerize and as a consequence, to autophosphorylate in vivo. Thus, the FHA domain is a multifunctional domain that contributes binding surfaces for substrate docking and oligomerization, some of which are dependent on pT and others not.

Serine 516 was identified as a novel IR-inducible Chk2 phosphorylation site in vivo. Within 30 min after exposure to IR, Chk2 became stoichiometrically phosphorylated on S516 in vivo (Fig. 3B). Mutation of serine 516 to alanine did not impair the ability of IR to activate the kinase activity of Chk2 (Fig. 4) or to induce a phosphorylation-dependent shift in the electrophoretic mobility of Chk2 (Fig. 3C). Nor did mutation of S516 disrupt the ability of Chk2 to oligomerize in 293 cells (data not shown). Failure to observe oligomerization defects is consistent with models proposed by Ahn et al. (22) and Xu et al. (23) who argue that oligomerization of Chk2 is mediated through FHA-dependent interactions with the phosphorylated amino terminus of Chk2. Thus, it is unclear at this point how serine 516 phosphorylation is regulating Chk2 function. However, the identification of a DNA damage-inducible phosphorylation site in the COOH terminus of Chk2, outside of previously characterized functional domains, suggests that this region may contribute to Chk2 regulation. Interestingly, truncation mutants that lack the COOH-terminal domain but possess an intact kinase domain, are kinase-inactive (data not shown). In addition, this domain may regulate the interactions of Chk2 with regulatory proteins or substrates or perhaps contribute to the localization of Chk2 following checkpoint activation. Further experimentation is required to address these possibilities.

Expression of kinase-inactive Chk2 in cells containing and lacking endogenous Chk2 allowed us to investigate the dependency of various Chk2 phosphorylation sites on Chk2 kinase activity. We found that phosphorylation of kinase-inactive Chk2 on T68 can occur in the absence of IR, in the absence of endogenous Chk2 (Figs. 1F, 3C, and 5, B and D), in the absence of ATM (Fig. 5C), and in the presence of caffeine (data not shown). Thus, kinases in addition to ATM and Chk2 can phosphorylate Chk2 on T68. Recently, PLK1 was reported to phosphorylate Chk2 on T68 (29). In contrast, S516 phosphorylation is absolutely dependent on the kinase activity of Chk2 because kinase-inactive Chk2 was not phosphorylated on S516 following IR, even in cells containing endogenous Chk2 (Figs. 3C and 5D). Phosphorylation of T383/T387 also requires the kinase activity of Chk2 and appears to occur in trans because kinase-inactive Chk2 was not phosphorylated on T383/T387 in cells lacking Chk2 (Fig. 5D) but was phosphorylated on T383/T387 when cells containing Chk2 were irradiated (Fig. 3C).

Our findings together with those of Ahn et al. (22), Xu et al. (23), and others (15–17, 22) support a model in which IR activates ATM to phosphorylate Chk2 on T68 (14–17). Phosphorylation partially activates the kinase activity of Chk2 and promotes its interactions with a second Chk2 molecule through the FHA domain of the second molecule (22, 23). This in turn promotes the trans-phosphorylation of T383/T387 to activate the second Chk2 molecule which then further activates itself and other Chk2 molecules through cis- and trans-phosphorylation events (see Fig. 7).



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 7. Model of Chk2 activation in vivo. Ionizing radiation (IR) activates ATM to phosphorylate Chk2 on T68. T68 phosphorylation partially activates the kinase activity of Chk2 and also promotes interactions with other Chk2 proteins via their FHA domains. This allows the associated Chk2 proteins to be activated by phosphorylation of T383/T387 in trans. Chk2 then undergoes autophosphorylation at S516 and T68. This autoactivation pathway allows Chk2 to become rapidly activated in response to IR. Kinases other than ATM and Chk2 are also capable of phosphorylating Chk2 on T68. See text for additional details.

 

   Materials and Methods
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
Acknowledgements
 References
 
Antibodies and Western Blotting
Chk2 was detected with a rabbit polyclonal antibody raised against bacterially produced glutathione S-transferase (GST)-Chk2 (30) or with a mouse monoclonal anti-Chk2 antibody (RT-1330-P, Neomarkers or sc-5278, Santa Cruz Biotechnology, Santa Cruz, CA). Chk2 fusion proteins were precipitated with anti-Flag M2 antibody-agarose affinity gel (Sigma Chemical Co.) and detected by Western blotting with anti-Flag M2 monoclonal antibody (Sigma, St. Louis, MO). Myc-Chk2 and 3XMyc-Chk2 fusion proteins were immunoprecipitated with anti-c-Myc mouse monoclonal 9E10 conjugated agarose (Santa Cruz Biotechnology) and detected by Western blotting with anti-c-Myc A14 rabbit polyclonal antibody (Santa Cruz Biotechnology). Bound primary antibodies were detected with either horseradish peroxidase-conjugated goat anti-mouse antibody (ICN/CAPPEL) or horseradish peroxidase-goat anti-rabbit (Zymed, San Francisco, CA), and proteins were visualized using the ECL reagent (Amersham, Piscataway, NJ). In some cases, proteins were visualized using the ECL+ reagent (Amersham) and quantified using the STORM system (Molecular Biosystems, Piscataway, NJ). Antibodies specific for Chk2 phosphorylated on T68 were generated by immunization of rabbits with the phosphopeptide CETVS-pT-QELYS coupled to keyhole limpet hemocyanin (KLH). Antibodies specific for Chk2 phosphorylated on serine 516 were generated by immunization of rabbits with the phosphopeptide CLAQP-pS-TSRKR coupled to KLH. Antibodies specific for Chk2 phosphorylated on threonines 383 and 387 were generated by immunization of rabbits with the phosphopeptide KR-pT-LCG-pT-PTY coupled to KLH.

Cell Culture and Irradiation
HeLa and 293 cells were routinely maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 100 units/ml penicillin and streptomycin. Chk2 knockout MEFs were routinely maintained in DMEM supplemented with 10% FBS, 100 units/ml penicillin and streptomycin, 2 mM L-glutamine, 0.1 mM nonessential amino acids, and 140 µM 2-mercaptoethanol. AT22IJE-T fibroblasts (cells lacking functional ATM) (25) were cultured in DMEM supplemented with 15% FBS, 2 mM L-glutamine, 100 units/ml penicillin and streptomycin, and 100 µg/ml hygromycin B. In some cases, cells were exposed to 10 Gy from a 60Co source.

Plasmids
pGEX2TN-Chk2 and pET15b-Chk2 have been described previously (30). 3XFlag-Chk2 was generated by digesting pGEX2TN-Chk2 with NdeI and then filling in with Klenow. The Chk2 insert was released from pGEX2TN by digesting with EcoRI. The NdeI/EcoRI Chk2 fragment was ligated into HindIII/EcoRI digested p3XFlag-CMV-10 vector (Sigma). 3XFlag-Chk2(D368N) was generated by site-directed mutagenesis of 3XFlag-Chk2 using the Quick-Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the following primers: 5'- GACTGTCTTATAAAGATTACTAATTTTGGGCACTCCAAGATTTTG (forward) and 5'-CAAAATCTTGGAGTGCCCAAAATTAGTAATCTTTATAAGACAGTC (reverse). These primers were also used to generate pET15b-Chk2(D368N) by site-directed mutagenesis of pET15b-Chk2. 3XFlag-Chk2(T68A) was generated by site-directed mutagenesis of 3XFlag-Chk2 and the following primers: 5'-GAGCTCCTTAGAGACAGTGTCCGCTCAGGAACTCTATTCTATTCCTGAG (forward) and 5'-CTCAGGAATAGAATAGAGTTCCTGAGCGGACACTGTCTCTAAGGAGCTC (reverse). 3XFlag-Chk2(S516A) was generated by site-directed mutagenesis of 3XFlag-Chk2 and the following primers: 5'-GTTCTAGCCCAGCCTGCCACTAGTCGAAAGCGG (forward) and 5'-CCGCTTTCGACTAGTGGCAGGCTGGGCTAGAC (reverse). The same primers were used to generate pGEX2TN-Chk2(S516A) by site-directed mutagenesis of pGEX2TN-Chk2 vector. A single Myc tag was added to Chk2 by PCR using the primers: 5'-ATATTAGGTACCATGGCAGAACAGAAGCTCATTTCTGAAGAAGACTTGTCTCGGGAGTCGGATGTTGAGGC (forward) and 5'-ATAGAATTCCTCGAGTCACAACACAGCAGCACACAC (reverse). The PCR product was digested with KpnI and XhoI and inserted into the corresponding sites of pCDNA3 to generate pCDNA3-Myc-Chk2. 3XMyc-Chk2 was generated by adding two additional Myc tags to Myc-Chk2 by PCR using the following primers: 5'-ATATTAGGTACCATGGAACAAAAGTTGATTTCTGAAGAAGATTTGAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGCAGAACAGAAGCTCATTTCTG (forward) and 5'-ATAGAATTCCTCGAGTCACAACACAGCAGCACACAC (reverse). The PCR product was digested with KpnI and XhoI and ligated into the corresponding sites of pCDNA3 to generate 3XMyc-Chk2. 3XMyc-Chk2(S516A) was generated by site-directed mutagenesis of 3XMyc-Chk2 using the S516A primers listed above. 3XFlag-Chk2 (I157T) and Myc-Chk2 (I157T) were generated by site-directed mutagenesis of 3XFlag-Chk2 and Myc-Chk2 using the following primers: 5'-GGTCCTAAAAACTCTTACACTGCATACATAGAAGATCACAGTGGC (forward) and 5'-GCCACTGTGATCTTCTATGTATGCAGTGTAAGAGTTTTTAGGACC (reverse). Sequences of all mutants were verified by DNA sequencing.

Two-Dimensional Phosphopeptide Mapping
293 cells (1.4 x 106) were either mock transfected or transfected with plasmids encoding 3XFlag-tagged wild-type and mutant forms of Chk2 using the Superfect transfection reagent (Qiagen, Valencia, CA). Forty hours post transfection, cells were incubated in phosphate-free DMEM containing 2.5 mCi of 32P-labeled inorganic phosphate per milliliter and 25 µM VP-16 for 2 h. Cells were washed once with ice-cold PBS and lysed in Mammalian Cell Lysis Buffer [MCLB, 50 mM Tris-HCl (pH 8), 150 mM NaCl, 0.5% NP40, 5 mM EDTA, 2 mM DTT, 1 µM microcystin, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 10 µg/ml aprotinin]. Ectopically expressed Chk2 was immunoprecipitated with anti-Flag M2 monoclonal antibody prebound to agarose (Sigma). Immunoprecipitates were subjected to SDS-PAGE on an 8% polyacrylamide gel, and proteins were transferred to nitrocellulose. Radiolabeled Chk2 was digested in a solution containing 1 mg/ml of chymotrypsin (Boehringer Mannheim, Germany) in 50 mM ammonium bicarbonate for 15 h. Chymotryptic phosphopeptides were separated in the first dimension by electrophoresis and in the second dimension by ascending chromatography in a buffer consisting of n-butanol-pyridine-acetic acid-water in a ratio of 75/50/15/60 (31). Endogenous Chk2 was immunoprecipitated from labeled HeLa lysate with affinity-purified polyclonal antibody and protein A-Sepharose beads. To monitor the phosphorylation of recombinant Chk2 in vitro, bacterially produced GST-Chk2 (30) was incubated in incomplete kinase buffer [50 mM Tris-HCl (pH 7.4), 1 mM DTT, 10 mM MgCl2] containing 10 µM ATP and 10 µCi of {gamma}-32P-ATP for 30 min at 30°C. The reaction was stopped by the addition of Laemmli buffer and boiling for 10 min. Radiolabeled Chk2 was resolved by SDS-PAGE, digested with chymotrypsin, and analyzed as described above.

Expression, Purification, and Activity of Bacterially Produced Chk2 Protein
E. coli strain BL21 was transformed with pET15b plasmids encoding His6-Chk2 or His6-Chk2(D368N). Cultures were grown at 37°C to an absorbance at 600 nm (A600 nm) of 0.6, and isopropyl-1-thio-D-galactopyranoside (IPTG) was added to a final concentration of 0.5 mM. Ten-milliliter samples of the induced cultures were pelleted at the indicated times and frozen at -80°C. Frozen pellets were resuspended in NP40 lysis buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM EGTA, 0.5% NP40] supplemented with protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 0.15 units/ml of aprotinin, 20 µM leupeptin) and 1 mg/ml lysozyme and rocked at 4°C for 20 min. Cells were lysed by sonication (50% duty cycle for 20 bursts). Lysates were clarified by centrifugation (13,000xg for 15 min). Proteins were precipitated by incubation with Ni2+-NTA agarose (Qiagen) for 1 h at 4°C. Precipitated proteins were washed three times in NP40 lysis buffer and eluted by boiling in 400 µl Laemmli boiling buffer. Twenty microliters of each sample was resolved by SDS-PAGE, and transferred to nitrocellulose followed by Western blotting with mouse monoclonal anti-Chk2 antibody (Neomarkers). To normalize protein amounts/lane, protein was quantified by ECL+ and phosphorimager analysis. Equivalent protein amounts determined by this method were re-run on SDS-PAGE and Western blotted with the indicated antibodies.

His-tagged fusion proteins were precipitated by incubation with Ni2+-NTA agarose (Qiagen) for 1 h at 4°C as described above. Precipitates were washed once with NP40 lysis buffer without detergent, once with LiCl buffer [0.5 M LiCl, 50 mM Tris (pH 8.0)], once with NP40 lysis buffer without detergent, and once with incomplete kinase buffer. Fifty-microliter kinase reactions were carried out in the presence of incomplete kinase buffer containing 10 µM ATP, 10 µCi {gamma}-32P-ATP, and 5 µg of soluble GST-Cdc25C(200–256) (32). Reaction mixtures were incubated at 30°C for 5–15 min. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose membrane. Radiolabeled proteins were visualized by autoradiography and Ponceau S staining. Incorporated counts were quantified by scintillation counting. Trans-phosphorylation assays of Chk2 were performed by incubating His6-Chk2(D368N) purified from 10 ml induced culture and bound to Ni2+-NTA agarose as described above with 100 ng of soluble GST-Chk2(wt) in the presence of incomplete kinase buffer and 1 mM ATP for 20 min. Reactions were resolved by SDS-PAGE, transferred to nitrocellulose, followed by Western Blotting with the indicated phospho-specific antibodies.

Chk2 Phosphorylation in the Absence and Presence of IR
HeLa cells were transfected with 10 µg 3XFlag-Chk2 (wt or mutants) plus 10 µg pcDNA3 by calcium phosphate transfection according to the manufacturer's guidelines (Life Technologies, Inc., Carlsbad, CA). Forty hours post transfection, cells were either mock-irradiated or irradiated with 10 Gy {gamma}-IR. Cells were harvested at 30 min, 1 h, and 2 h post irradiation and lysed in MCLB. Ectopically expressed Chk2 was immunoprecipitated with anti-Flag agarose (Sigma) from 3 mg of total cell lysate. Immunoprecipitates were divided equally into three parts and subjected to SDS-PAGE on 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and Western blotted with phospho-specific antibodies for T68, T383/T387, and S516. Membranes were stripped and re-probed with an antibody against the flag epitope.

For Chk2 knockout MEF studies, 10 µg 3XFlag-Chk2(D368N) were transfected into MEFs using the LipofectAMINE 2000 reagent (Invitrogen, Carlsbad, CA). Forty-eight hours post transfection, cells were either mock- or {gamma}-irradiated with 10 Gy IR. Cells were harvested 1 h post IR. Ectopically expressed Chk2 was immunoprecipitated with anti-Flag agarose (Sigma), and immunoprecipitates were subjected to SDS-PAGE on 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and Western blotted with phospho-specific antibodies for T68, T383/T387, and S516. Membranes were stripped and re-probed with an antibody against the flag epitope.

Cycloheximide Experiments
HeLa cells were transfected with 10 µg 3XFlag-Chk2 plus 10 µg pcDNA3 by calcium phosphate transfection according to the manufacturer's guidelines (Life Technologies). Forty hours post transfection, cells were treated with 25 µg/ml cycloheximide for 1 h. Cells were then either mock-irradiated or irradiated with 10 Gy {gamma}-IR. Cells were harvested at 30 min, 1 h, 2 h, and 3 h post irradiation and lysed in MCLB. Seventy-five micrograms of total lysate were resolved by SDS-PAGE, transferred to nitrocellulose, and blotted with the Santa Cruz Chk2 monoclonal antibody.

Activation of Chk2 Kinase Activity by IR
HeLa cells were transfected with 10 µg pCDNA3 plasmid plus 10 µg 3XFlag-Chk2 (wt or mutants) by calcium phosphate transfection. Forty hours post transfection, cells were either mock- or {gamma}-irradiated with 10 Gy IR. After 30 min of incubation, cells were harvested and lysed in MCLB. Chk2 proteins were immunoprecipitated with flag agarose, washed three times with MCLB and once with incomplete kinase buffer [50 mM Tris-HCl (pH 7.4), 10 mM MgCl2, 1 mM DTT]. Fifty-microliter kinase reactions were carried out in the presence of incomplete kinase buffer containing 10 µM ATP, 10 µCi of {gamma}-32P-ATP, and 5 µg of soluble GST-Cdc25C(200–256). Reaction mixtures were incubated at 30°C for 10 min and resolved by SDS-PAGE. Incorporated counts were quantified using a phosphorimager (Molecular Biosystems). Error bars represent average counts of triplicate reactions performed for each mutant (Fig. 4B) or duplicate reactions performed for each mutant (Fig. 4C).

Oligomerization of Chk2
Five micrograms of 3XFlag-Chk2 and 5 µg of Myc-Chk2 were cotransfected into 293 cells using the Superfect reagent (Qiagen). Thirty-six hours post transfection, cells were harvested and lysed in MCLB. Lysates were immunoprecipitated with anti-flag (Sigma) and anti-Myc agarose (Santa Cruz Biotechnology). Immunoprecipitates were washed three times in MCLB. Bound proteins were released by boiling in Laemmli boiling buffer, resolved by SDS-PAGE, and visualized by Western blotting with the indicated antibodies.

For I157T oligomerization studies, 5 µg 3XFlag-Chk2(I157T) and 5 µg Myc-Chk2(I157T) or 5 µg 3XFlag-Chk2 and 5 µg Myc-Chk2 were cotransfected into Chk2-/- MEFs using the LipofectAMINE 2000 reagent (Invitrogen). At 33 h post transfection, cells were harvested and lysed in MCLB. Lysates were immunoprecipitated with anti-flag agarose (Sigma) or with anti-Myc agarose (Santa Cruz Biotechnology) for 3 h at 4°C. Immunoprecipitates were subsequently washed three times with MCLB. Bound proteins were released by boiling in Laemmli boiling buffer, resolved by SDS-PAGE, and visualized with the indicated antibodies.

Generation of Recombinant Adenoviruses
Wild-type and kinase inactive forms of Chk2 were cloned as flag-tagged or Myc-tagged fusions into the adenovirus shuttle vector pAdtrack-CMV (33). pcDNA3/CMV-flagChk2 and pcDNA3/CMV-mycChk2 D368N were digested with Kpn1 and Xho1, and the fragments encoding flag-Chk2 or myc-Chk2 D368N were cloned into Kpn1/Xho1 digested pAdtrack-CMV to generate pAdtrack-CMV-flagChk2 and pAdtrack-CMV-mycChk2, respectively. The pAdtrack-CMV-based plasmids encoding Chk2 WT and Chk2 D368N proteins were cotransformed with pAdEasy-1 into E. coli BJ5183 to achieve homologous recombination. Recombinant adenoviruses were generated and propagated using the pAdEasy system as described previously (33).

AT Cell Experiments
AT cells were infected for 60 min with recombinant adenoviruses encoding flag-tagged Chk2 wild-type or myc-tagged Chk2 D368N at a multiplicity of infection of 10 or 5, respectively, in 1 ml of serum-free DMEM. After 1 h, 10 ml of culture medium were added. Twenty-eight hours post infection, cells were harvested and lysed in MCLB. Chk2 proteins were immunoprecipitated with a polyclonal Chk2 antibody and protein A-Sepharose (Pierce, Rockford, IL). Immunoprecipitates were washed four times with MCLB, resolved by SDS-PAGE, and visualized with the indicated antibodies.


   Acknowledgements
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
References
 
We thank Dr. Tak Mak (University of Toronto) for providing the Chk2 knockout MEFs. In addition, we thank Dr. Sarah Meek and Dr. Robert Mercer for computer support.


   Notes
Top
 Notes
Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
1 NIH. Note: H.P.W. is an investigator of the Howard Hughes Medical Institute. C.M.L. and J.K.S. are members of the Medical Scientist Training Program at Washington University School of Medicine. Note: J.K.S. and C.M.L. contributed equally to this work. Back

Received February 5, 2003; revised April 16, 2003; accepted April 28, 2003.


   References
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 

  1. Elledge, S. J. Cell cycle checkpoints: preventing an identity crisis. Science, 274: 1664–1672, 1996.[Abstract/Free Full Text]
  2. Bentley, N. J., Hawkins, G., Keegan, K., DeMaggio, A., Holtzman, D., Ford, J. C., Hoekstra, M., and Carr, A. M. The Schizosaccharomyces pombe rad3 checkpoint gene. EMBO J., 15: 6641–6651, 1996.[Medline]
  3. Cimprich, K. A., Shin, T. B., Keith, C. T., and Schreiber, S. L. cDNA cloning and gene mapping of a candidate human cell cycle checkpoint protein. Proc. Natl. Acad. Sci. USA, 93: 2850–2855, 1996.[Abstract/Free Full Text]
  4. Shiloh, Y. Ataxia-telangiectasia and Nijmegen breakage syndrome: related disorders but genes apart. Annu. Rev. Genet., 31: 635–662, 1997.[Medline]
  5. Kastan, M. B., Zhan, Q., El-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fornace, A. J., Jr. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in Ataxia Telangiectasia. Cell, 71: 587–597, 1992.[Medline]
  6. Blasina, A., Van de Weyer, I., Laus, M. C., Luyten, W. H. M. L., Parker, A. E., and McGowan, C. H. A human homologue of the checkpoint kinase Cds1 directly inhibits Cdc25 phosphatase. Curr. Biol., 9: 1–10, 1998.
  7. Brown, A., Lee, C-H., Schwarz, J. K., Mitiku, N., Griffith, D., Piwnica-Worms, H., and Chung, J. H. A human Cds1-related kinase that functions downstream of ATM in the cellular response to DNA damage. Proc. Natl. Acad. Sci. USA, 96: 3745–3750, 1999.[Abstract/Free Full Text]
  8. Chaturvedi, P., Eng, W. K., Zhu, Y., Mattern, M. R., Mishra, R., Hurle, M. R., Zhang, X., Annan, R. S., Lu, Q., Faucette, L. F., Scott, G. F., Li, X., Carr, S. A., Johnson, R. K., Winkler, J. D., and Zhou, B-B. S. Mammalian Chk2 is a downstream effector of the ATM-dependent DNA damage checkpoint pathway. Oncogene, 18: 4047–4054, 1999.[Medline]
  9. Matsuoka, S., Huang, M., and Elledge, S. J. Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science, 282: 1893–1897, 1998.[Abstract/Free Full Text]
  10. Chehab, N. H., Malikzay, A., Appel, M., and Halazonetis, T. D. Chk2/hCds1 functions as a DNA damage checkpoint in G1 by stabilizing p53. Genes Dev., 14: 278–288, 2000.[Abstract/Free Full Text]
  11. Takai, H., Naka, K., Okada, Y., Watanabe, M., Harada, N., Saito, S., Anderson, C. W., Appella, E., Nakanishi, M., Suzuki, H., Nagashima, K., Sawa, H., Ikeda, K., and Motoyama, N. Chk2-deficient mice exhibit radioresistance and defective p53-mediated transcription. EMBO J., 21: 5195–5205, 2002.[Medline]
  12. Hirao, A., Cheung, A., Duncan, G., Girard, P. M., Elia, A. J., Wakeham, A., Okada, H., Sarkissian, T., Wong, J. A., Sakai, T., De Stanchina, E., Bristow, R. G., Suda, T., Lowe, S. W., Jeggo, P. A., Elledge, S. J., and Mak, T. W. Chk2 is a tumor suppressor that regulates apoptosis in both an ataxia telangiectasia mutated (ATM)-dependent and an ATM-independent manner. Mol. Cell. Biol., 22: 6521–6532, 2002.[Abstract/Free Full Text]
  13. Bell, D. W., Variey, J. M., Szydlo, T. E., Kang, D. H., Wahrer-Doke, C. R., Shannon, K. E., Lubratovich, M., Versellls, S. J., Isselbacher, K. J., Fraumeni, J. F., Birch, J. M., Li, F. P., Garber, J. E., and Haber, D. A. Heterozygous germ line hCHK2 mutations in Li-Fraumeni Syndrome. Science, 286: 2528–2531, 1999.[Abstract/Free Full Text]
  14. Ahn, J-Y., Schwarz, J. K., Piwnica-Worms, H., and Canman, C. E. Threonine 68 phosphorylation by ataxia telangiectasia mutated is required for efficient activation of Chk2 in response to ionizing radiation. Cancer Res., 60: 5934–5936, 2000.[Abstract/Free Full Text]
  15. Matsuoka, S., Rotman, G., Ogawa, A., Shiloh, Y., Tamai, K., and Elledge, S. J. Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro. Proc. Natl. Acad. Sci. USA, 97: 10389–10394, 2000.[Abstract/Free Full Text]
  16. Melchionna, R., Chen, X. B., Blasina, A., and McGowan, C. H. Threonine 68 is required for radiation-induced phosphorylation and activation of Cds1. Nat. Cell Biol., 2: 762–765, 2000.[Medline]
  17. Zhou, B. B., Chaturvedi, P., Spring, K., Scott, S. P., Johanson, R. A., Mishra, R., Mattern, M. R., Winkler, J. D., and Khanna, K. K. Caffeine abolishes the mammalian G(2)/M DNA damage checkpoint by inhibiting ataxia-telangiectasia-mutated kinase activity. J. Biol. Chem., 275: 10342–10348, 2000.[Abstract/Free Full Text]
  18. Lee, C-H. and Chung, J. H. The hCds1 (Chk2)-FHA domain is essential for a chain of phosphorylation events on hCds1 that is induced by ionizing radiation. J. Biol. Chem., 276: 30537–30541, 2001.[Abstract/Free Full Text]
  19. Durocher, D., Henckel, J., Fersht, A. R., and Jackson, S. P. The FHA domain is a modular phosphopeptide recognition motif. Mol. Cell, 4: 387–394, 1999.[Medline]
  20. Durocher, D., Taylor, I. A., Sarbassova, D., Haire, L. F., Westcott, S. L., Jackson, S. P., Smerdon, S. J., and Yaffe, S. P. The molecular basis of FHA domain: phosphopeptide binding specificity and implications for phosph-dependent signaling mechanisms. Mol. Cell, 6: 1169–1182, 2000.[Medline]
  21. Li, J., Williams, B. L., Haire, L. F., Goldberg, M., Wilker, E., Durocher, D., Yaffe, M. B., Jackson, S. P., and Smerdon, S. J. Structural and functional versatility of the FHA domain in DNA-damage signaling by the tumor suppressor kinase Chk2. Mol. Cell, 9: 1045–1054, 2002.[Medline]
  22. Ahn, J-Y., Li, X., Davis, H. L., and Canman, C. E. Phosphorylation of Threonine 68 promotes oligomerization and autophosphorylation of the Chk2 protein kinase via the forkhead-associated (FHA) domain. J. Biol. Chem., 277: 19389–19395, 2002.[Abstract/Free Full Text]
  23. Xu, X., Tsvetkov, L. M., and Stern, D. F. Chk2 activation and phosphorylation-dependent oligomerization. Mol. Cell. Biol., 22: 4419–4432, 2002.[Abstract/Free Full Text]
  24. Gilbert, C. S., Green, C. M., and Lowndes, N. F. Budding yeast Rad9 is an ATP-dependent Rad53 activating machine. Mol. Cell, 8: 129–136, 2001.[Medline]
  25. Ziv, Y., Bar-Shira, A., Pecker, I., Russell, P., Jorgensen, T., Tsarfati, I., and Shiloh, Y. Recombinant ATM protein complements the cellular A-T phenotype. Oncogene, 15: 159–167, 1997.[Medline]
  26. Wu, X., Webster, S. R., and Chen, J. Characterization of tumor-associated Chk2 mutations. J. Biol. Chem., 276: 2971–2974, 2001.[Abstract/Free Full Text]
  27. Ward, I. M., Wu, X., and Chen, J. Threonine 68 of Chk2 is phosphorylated at sites of DNA strand breaks. J. Biol. Chem., 276: 47755–47758, 2001.[Abstract/Free Full Text]
  28. Lukas, C., Falck, J., Bartkova, J., Bartek, J., and Lukas, J. Distinct spatiotemporal dynamics of mammalian checkpoint regulators induced by DNA damage. Nat. Cell Biol., 5: 255–260, 2003.[Medline]
  29. Tsvetkov, L. M., Xu, X., Li, J., and Stern, D. F. Polo-like kinase 1 and Chk2 interact and co-localize to centrosomes and the midbody. J. Biol. Chem., 278: 8468–8475, 2003.[Abstract/Free Full Text]
  30. Graves, P. R., Yu, L., Schwarz, J. K., Gales, J., Sausville, E. A., O'Connor, P. M., and Piwnica-Worms, H. The Chk1 protein kinase and the Cdc25C regulatory pathway are targets of the anticancer agent UCN-01. J. Biol. Chem., 275: 5600–5605, 2000.[Abstract/Free Full Text]
  31. van der Geer, P. and Hunter, T. Phosphopeptide mapping and phosphoamino acid analysis by electrophoresis and chromatography on thin-layer cellulose plates. Electrophoresis, 15: 544–554, 1994.[Medline]
  32. Ogg, S., Gabrielli, B., and Piwnica-Worms, H. Purification of a serine kinase that associates with and phosphorylates human Cdc25C on serine 216. J. Biol. Chem., 269: 30461–30469, 1994.[Abstract/Free Full Text]
  33. He, T-C., Zhou, S., DaCosta, L. T., Yu, J., Kinzler, K. W., and Vogelstein, B. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci., 95: 2509–2514, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
E. M. Kass, J. Ahn, T. Tanaka, W. A. Freed-Pastor, S. Keezer, and C. Prives
Stability of Checkpoint Kinase 2 Is Regulated via Phosphorylation at Serine 456
J. Biol. Chem., October 12, 2007; 282(41): 30311 - 30321.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. K. Gupta, X. Guo, S. S. Durkin, K. F. Fryrear, M. D. Ward, and O. J. Semmes
Human T-cell Leukemia Virus Type 1 Tax Oncoprotein Prevents DNA Damage-induced Chromatin Egress of Hyperphosphorylated Chk2
J. Biol. Chem., October 5, 2007; 282(40): 29431 - 29440.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
V. A. Rao, C. Conti, J. Guirouilh-Barbat, A. Nakamura, Z.-H. Miao, S. L. Davies, B. Sacca, I. D. Hickson, A. Bensimon, and Y. Pommier
Endogenous {gamma}-H2AX-ATM-Chk2 Checkpoint Activation in Bloom's Syndrome Helicase Deficient Cells Is Related to DNA Replication Arrested Forks
Mol. Cancer Res., July 1, 2007; 5(7): 713 - 724.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Rellos, F. J. Ivins, J. E. Baxter, A. Pike, T. J. Nott, D.-M. Parkinson, S. Das, S. Howell, O. Fedorov, Q. Y. Shen, et al.
Structure and Regulation of the Human Nek2 Centrosomal Kinase
J. Biol. Chem., March 2, 2007; 282(9): 6833 - 6842.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
G. Buscemi, L. Carlessi, L. Zannini, S. Lisanti, E. Fontanella, S. Canevari, and D. Delia
DNA Damage-Induced Cell Cycle Regulation and Function of Novel Chk2 Phosphoresidues
Mol. Cell. Biol., November 1, 2006; 26(21): 7832 - 7845.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Takemura, V. A. Rao, O. Sordet, T. Furuta, Z.-H. Miao, L. Meng, H. Zhang, and Y. Pommier
Defective Mre11-dependent Activation of Chk2 by Ataxia Telangiectasia Mutated in Colorectal Carcinoma Cells in Response to Replication-dependent DNA Double Strand Breaks
J. Biol. Chem., October 13, 2006; 281(41): 30814 - 30823.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Yang, J.-H. Jeong, A. L. Brown, C.-H. Lee, P. P. Pandolfi, J. H. Chung, and M. K. Kim
Promyelocytic Leukemia Activates Chk2 by Mediating Chk2 Autophosphorylation
J. Biol. Chem., September 8, 2006; 281(36): 26645 - 26654.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Yoda, X. Z. Xu, N. Onishi, K. Toyoshima, H. Fujimoto, N. Kato, I. Oishi, T. Kondo, and Y. Minami
Intrinsic Kinase Activity and SQ/TQ Domain of Chk2 Kinase as Well as N-terminal Domain of Wip1 Phosphatase Are Required for Regulation of Chk2 by Wip1
J. Biol. Chem., August 25, 2006; 281(34): 24847 - 24862.
[Abstract]