Molecular Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Bridging the Lab and the Clinic in Cancer Medicine
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tiwari, G.
Right arrow Articles by Roth, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tiwari, G.
Right arrow Articles by Roth, R. A.
Molecular Cancer Research 1:475-484 (2003)
© 2003 American Association for Cancer Research


Signaling and Regulation

Gene Expression Profiling in Prostate Cancer Cells With Akt Activation Reveals Fra-1 As an Akt-Inducible Gene1

Gunjan Tiwari1, Hiroshi Sakaue1, Jonathan R. Pollack2 and Richard A. Roth1

1 Department of Molecular Pharmacology, Stanford University and 2 Department of Pathology, Stanford University School of Medicine, Stanford, CA

Requests for reprints: Richard A. Roth, Stanford University School of Medicine, Center for Clinical Sciences Research, Room 3145B, Stanford, CA 94305-5174. Phone: (650) 723-5933; Fax: (650) 723-2253. E-mail: rroth{at}stanford.edu


    Abstract
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
To determine which genes may be regulated by Akt and participate in the transformation of cells, we have examined by microarray analyses genes turned on in the prostate cancer cell line, PC3, when Akt activity was induced. PC3 cells, which lack the lipid phosphatase PTEN, were treated overnight with a reversible inhibitor of the phosphatidylinositol 3-kinase, LY294002 (a treatment which was found to reversibly decrease Akt enzymatic activity). The inhibitor was then washed out and mRNA collected 2, 6, and 10 h later and compared by microarray analyses with mRNAs present immediately after removal of the inhibitor. One of the identified induced mRNAs, Fra-1, was further studied by transient transfections of a reporter construct containing its 5' regulatory region. This construct was found to be directly induced 4- to 5-fold by co-transfection with constitutively active Akt3 but not kinase dead Akt. The regulation by Akt3 was found to be due to two specific regions in the Fra-1 regulatory sequence which match Sp1 consensus sites. Finally, gel shift studies showed that the binding of Sp1 to one of these sites was dependent on the PI 3-kinase pathway. These results indicate that LY294002 treatment and washout is a useful method to study the activation of Akt in the context of a tumor cell. Moreover, the identification of Fra-1 as an Akt-regulated gene may have implications for the ability of Akt to transform cells since Fra-1 has been implicated in cell growth and the aggressiveness of tumors.

Key Words: transcription • Sp1 • microarray • PI 3-kinase


    Introduction
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
One of the intracellular signaling pathways frequently activated in cancer cells is the phosphatidylinositol (PI) 3-kinase pathway (1). PI 3-kinases catalyze the formation of the 3' phosphoinositides, phosphatidylinositol 3,4-diphosphate, and phosphatidylinositol 3,4,5-triphosphate (2). The production of these lipids is stimulated in cells by a variety of growth factors including heregulin and other members of the epidermal growth factor family as well as by the insulin-like growth factors I and II. Increased levels of these lipids are also found in cells which lack the tumor suppressor, PTEN (also called MMAC1) (3). This tumor suppressor is inactivated in a number of cancers including breast, glioblastomas, prostate, etc. and has been shown to be a PIP3 phosphatase (1, 3, 4). In addition, in mouse models in which PTEN has been inactivated by targeted deletion from one allele, there are increases in cancers of the endometrium, thyroid, prostate, breast, liver, and intestine (1).

Extensive studies have therefore been directed at identifying downstream targets of the PI 3-kinase pathway (5–8). In the last few years, a number of proteins which bind these lipids have been identified, including several ser/thr kinases such as the three isoforms of Akt (also called PKB), its activating kinase PDK-1, several isoforms of protein kinase C, serum and glucocorticoid-induced kinase (sgk), and even ERK in some systems. In addition, a number of other proteins have been found to bind these lipids specifically (e.g., GRIP-1) and these may link to other signaling cascades (9). In the case of Akt, increases in PIP3 lead to its membrane translocation and activation by phosphorylation (5, 6). Thus, this enzyme is constitutively active in cells lacking active PTEN. Akt has been shown capable of regulating numerous cellular functions including stimulation of cellular growth and division as well as inhibiting cellular death (apoptosis) (5, 7, 8). In addition, a number of downstream targets of Akt have been identified, including glycogen synthase kinase (GSK)-3, several mammalian homologues of the Caenorhabditis elegans DAF-16 transcription factor (now called Foxo 1, 3, and 4), the anti-apoptotic protein BAD, phosphodiesterase 3B, a Rab GTPase-activating protein, ATP-citrate lyase, and most recently, tuberous sclerosis complex-2, among others (5, 6, 10–12). How many or which of these substrates are involved in the transformation of cells is not known.

To better understand how the PI 3-kinase/Akt pathway can transform cells, we sought a method to study the activation of Akt in such a cell system. Although prior studies have reported on inducible forms of either the PI 3-kinase or Akt (13, 14), we sought a method that could more readily use available cell lines. In the present work, we report on such a system, a prostate cancer cell line lacking PTEN, PC3 cells. Moreover, we have used this system to categorize the genes induced by elevation of PIP3. Finally, we identify a gene, Fra-1, which is directly regulated by Akt and demonstrate that the regulation of Fra-1 transcription can be mapped to a PIP3-regulated binding of Sp1 to a retinoblastoma control element (RCE) in the Fra-1 promoter.


    Results
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Activation of Akt Kinase Activity in PC3 Cells and Identification of Genes Regulated by This Treatment
PC3 cells, which contain elevated basal levels of active Akt because they lack PTEN (15), were treated with a reversible inhibitor of PI 3-kinase, LY294002 (16). This treatment with 30 µM LY294002 was found sufficient to decrease Akt enzymatic activity by about 98% (Fig. 1). They were then washed and incubated for different periods of time without drug. On removal of LY294002, the enzymatic activity of Akt was rapidly regained, with about 50% of the enzymatic activity returning within 5 min. This treatment was therefore used to examine which genes were regulated in this system by removal of LY294002 in the hope of identifying genes the transcription of which was directly regulated by Akt.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1. Time course of Akt activation in PC3 cells following LY294002 withdrawal. PC3 cells were treated with 30 µM LY294002 overnight, washed twice, and then incubated in media without LY294002 for the indicated periods of time before lysis. Akt kinase activity was measured at the different time points as described in "Materials and Methods."

 
PC3 cells were therefore treated overnight with 30 µM LY294002, washed and allowed 2, 6, or 10 h to recover. The mRNA from these cells was hybridized to cDNA microarrays containing 17,083 distinct genes and scored against control mRNA from PC3 cells treated overnight with LY294002. The genes which were most consistently induced or repressed in three independent experiments to the greatest extent after LY294002 removal in PC3 cells are listed in Table 1. The increased expression of two genes, CYP1B1 and Fra-1, was confirmed by RT-PCR and Northern analysis (Fig. 2). In addition, an increase in Fra-1 protein could be observed after LY294002 removal (Fig. 2C).


View this table:
[in this window]
[in a new window]
 
Table 1. Genes Induced or Repressed in PC3 Cells After LY294002 Removala

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. CYP1B1 and Fra-1 induction in PC3 cells following LY294002 withdrawal. PC3 cells were treated overnight with LY294002, washed, and then incubated for the indicated times. The cells were then lysed, mRNA isolated, and the amount of CYP1B1 (A) or Fra-1 (B) was measured by reverse transcription (RT)-PCR or Northern, quantitated, and plotted as a fold over the control cells treated with LY294002. For comparison, we have also shown the amounts of these two mRNAs as determined by microarray analyses. C. Induction of the Fra-1 mRNA and protein after LY294002 removal. PC3 cells that were either untreated (-), LY294002 treated (LY) overnight, or LY294002 treated, washed, and given 2 or 6 h to recover were analyzed for Fra-1 mRNA by Northerns or Fra-1 protein by Western blotting.

 
Direct Regulation of Fra-1 Transcription by Akt
Removal of the PI 3-kinase inhibitor LY294002 could result in activation of genes in the PC3 cells by Akt as well as by other mechanisms because overall levels of PIP3 would increase in these cells, thereby resulting in the activation of all downstream targets of PIP3. To directly test whether Akt was responsible for the activation of the transcription of CYP1B1 and Fra-1, reporter constructs containing the 5' regulatory regions of these two genes were co-transfected with constitutively active Akt into MCF-7 cells. Because PC3 cells contain primarily Akt3 kinase activity (17), we used a constitutively active Akt3 construct. The CYP1B1 reporter construct [containing 2300 nucleotides (nt) of the 5' regulatory region of this gene] was found not to be induced by co-transfection with the constitutively active Akt3 (Fig. 3A), possible due to this gene being regulated via another downstream target of PI 3-kinase or because the reporter construct used lacked the key Akt regulatory region. A control of another activator of CYP1B1 transcription, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (18), did, however, stimulate the transcription of this reporter construct (Fig. 3A). Attempts to transfect the CYP1B1 reporter construct into PC3 cells and measure the ability of LY294002 washout to induce this transcript also failed, although the expression levels of this construct in these cells was quite low.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 3. Activation of the Fra-1 but not the CYP1B1 promoter by Akt3. MCF-7 cells were transiently transfected with either a CYP1B1 (pCYP1B1) (A) or a Fra-1 promoter-reporter construct (pFra) (B). The former contained 2.3 kb while the latter contained 749 nt of the 5'-regulatory regions of the CYP1B1 and Fra-1 genes, respectively, and the firefly luciferase coding region. These reporter constructs were co-transfected with a control plasmid encoding Renilla luciferase (pRL-CMV) and plasmids encoding either constitutively active Akt3 or kinase dead Akt3 (kdAkt3), where indicated. When the Akt plasmid was not included, the empty plasmid, pcDNA3.1, was substituted. Also, the cells were treated with 30 µM of the PI 3-kinase inhibitor, LY294002, or 10 nM of an activator of CYP1B1 transcription, TCDD, where indicated. Cells were lysed 48 h after transfection and firefly and Renilla luciferase activities were determined sequentially in the lysates. Results shown are the means ± SE of three independent experiments where the amount of firefly luciferase activity was normalized to the amount of Renilla luciferase activity measured in each sample. To verify that the kinase dead Akt3 was expressed, the lysates were also analyzed by Western blotting using anti-HA antibodies (C).

 
A reporter construct containing 749 nt 5' to the start site of transcription of Fra-1 was induced 4- to 5-fold on co-transfection with constitutively active Akt3 (Fig. 3). This level of stimulation was comparable to the increase in Fra-1 mRNA observed with removal of the PI 3-kinase inhibitor from the PC3 cells. Moreover, an Akt mutant in which the kinase activity was inactivated by mutation did not stimulate an increase in transcription of this Fra-1 reporter construct even though it was expressed at levels comparable to the active Akt3 (Fig. 3). Indeed, it appeared to even decrease the basal level of transcription of this construct, possible by acting as a functional dominant negative. However, it did not decrease the levels of transcription of the control reporter plasmid (pCMVRL) co-transfected in these experiments, indicating that this was not a general inhibitory affect of this plasmid on transcription.

To determine whether the observed stimulation of the Fra-1 reporter construct was unique to Akt3, similar studies were performed with a constitutively active Akt1 (19). Constitutively active Akt1 was found to stimulate the transcription of the reporter construct when it was expressed at low levels (Fig. 4). However, at higher levels, the Akt1 was found to actually inhibit Fra-1 transcription, possibly due to the ability of Akt1 to feedback and inhibit responses (20). This inhibition was not observed with Akt3 even though comparable levels of protein (Fig. 4) and kinase activity were expressed (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Comparison of Akt1 and Akt3 for their abilities to activate the Fra-1 promoter. MCF-7 cells were transiently transfected with a Fra-1 promoter-reporter construct (pFra4), the control Renilla luciferase plasmid, and the indicated amounts of plasmids encoding either constitutively active Akt1 (Akt1) or constitutively active Akt3 (Akt3). In each case, the total amount of cDNA transfected was kept constant by adding the empty plasmid pcDNA3.1. Forty-eight hours after transfection, the cells were lysed and luciferase activities measured. Results shown are the means ± SE of three independent experiments where the amount of firefly luciferase activity was normalized to the amount of Renilla luciferase activity measured in each sample. The lower panel shows the amounts of expressed Akt in the different transfected samples as detected in Western blots.

 
Identification of the Region Responsible for Akt Regulation of the Fra-1 Reporter Construct
The region responsible for the Akt3 regulation of the Fra-1 reporter construct was examined by preparing increasing deletions of the regulatory region. A construct which contained 161 nt 5' to the start site of transcription of Fra-1 was found to still be regulated by constitutively active Akt3 to a level comparable to that observed with the 749 nt construct, whereas a construct which had a further deletion of 56 nt lost the ability to be regulated by Akt3 (Fig. 5).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. Delineation of the Akt3 responsive elements in the Fra-1 promoter. A series of deletion fragments of the Fra-1 promoter was cloned in front of the firefly luciferase reporter vector (pGL3). The 5' ends of the promoter fragments are shown by the nucleotide position with respect to the transcription initiation site (A). The following potential regulatory sites as defined by Tsuchiya et al. (21) are also depicted: Sp1; FAP (fos AP1-like element); E box; Ets/TCF; CArG; and RCE (retinoblastoma control elements). The reporter constructs were co-transfected with the control Renilla luciferase plasmid and either constitutively active Akt3 or the pcDNA3.1 vector. Forty-eight hours after transfection, the cells were lysed and luciferase activities measured. Results shown are the means ± SE of three independent experiments where the amount of firefly luciferase activity was normalized to the amount of Renilla luciferase activity measured in each sample.

 
Prior analyses of the regulation of the Fra-1 gene (21) had identified an RCE site and a serum response element (SRE) in this region that we find critical for Akt3 regulation. In addition, there is a second RCE 3' to this region (Fig. 5A). We therefore analyzed the ability of active Akt3 to induce mutants of the Fra-1 reporter construct when either RCE1, RCE2, or both RCE1 and 2 were mutated. A mutation in RCE1 reduced the ability of Akt3 to induce the transcription of the reporter construct by 75%, whereas a mutation in RCE2 decreased induction by 40% (Fig. 6A). A construct in which both RCE1 and 2 were mutated exhibited essentially no induction by active Akt3 (Fig. 6B). The basal levels of transcription of this construct were also significantly reduced. In contrast, a mutation in the SRE had no major affect on the ability of active Akt3 to induce the transcription of the reporter construct (Fig. 6A).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of mutations of the SRE and RCE on the Akt activation of the Fra-1 promoter. The pFra4 reporter plasmid was mutated in either the SRE (mSRE) or the two RCE elements (mRCE1 and mRCE2) individually (A) or together (B). The reporter constructs were co-transfected with the control Renilla luciferase plasmid and either constitutively active Akt3 or the pcDNA3.1 vector as indicated. Forty-eight hours after transfection, the cells were lysed and luciferase activities measured. Results shown are the means ± SE of three independent experiments where the amount of firefly luciferase activity was normalized to the amount of Renilla luciferase activity measured in each sample.

 
Regulation of Sp1 Binding to RCE1 by the PI 3-Kinase Pathway
To further examine the mechanism for the regulation of Fra-1 gene by the PI 3-kinase pathway, we performed gel shift assays with a digoxigenin-labeled oligonucleotide containing the RCE1 site. Nuclear extracts from PC3 cells induced a shift of the RCE1 oligonucleotides (Fig. 7A, compare lanes 1 and 2) as seen by the formation of the two slower migrating bands (called C1 and C2) that were not observed in the absence of nuclear extracts. The formation of both of these complexes was blocked by an excess of the unlabeled version of this oligonucleotide (lanes 5–7). When the PC3 nuclear extracts were incubated with a labeled version of the oligonucleotide which contained a mutation in the RCE1 site (the same mutation as present in the mutant reporter construct), we still observed the C2 band but not the C1 band (lanes 9–11). Finally, nuclear extracts prepared from PC3 cells treated for 18 h with LY294002 exhibited a reduced amount of the C1 complex (Fig. 7A, lane 3), whereas nuclear extracts from PC3 cells which were treated with this inhibitor, washed, and then incubated for 5 h after removal of the inhibitor, showed a recovery of the C1 complex (Fig. 7A, lane 4). In contrast, no change in the amount of the C2 complex was observed with LY294002 treatment. These results as well as the results with the mutant RCE1 oligonucleotide implicate the components in the C1 but not the C2 complex in the PI 3-kinase regulation of the Fra-1 transcription. A similar PIP3 regulated binding of nuclear components to a labeled oligonucleotide containing the RCE2 element was not observed (data not shown).



View larger version (83K):
[in this window]
[in a new window]
 
FIGURE 7. Characterization of the complex formed at the Fra-1 RCE1. A. Demonstration of a PI 3-kinase-dependent gel shift with specificity for RCE1. Nuclear extracts (5 µg of protein) were prepared from non-treated (lanes 2, 5, 9), LY294002 treated (lanes 3, 6, 10), or LY294002 treated, washed, and allowed 5 h to recover (lanes 4, 7, 11) PC3 cells. These extracts were then incubated with digoxigenin-labeled double-stranded oligonucleotide probes containing either the wild-type Fra-1 RCE1 (lanes 2–7) or a mutated RCE1 site (lanes 9–11). Additional controls were to perform the incubations in the presence of a 50-fold molar excess of unlabeled RCE1 oligonucleotide (lanes 5–7) and to electrophorese the labeled oligonucleotides in the absence of the nuclear extracts (lanes 1, 8). The reaction mixtures were analyzed by electrophoretic separation on polyacrylamide gels, transfer to membranes and detection with alkaline phosphatase coupled anti-digoxigenin antibodies. The positions of bound oligonucleotide complexes are indicated as C1 and C2, respectively. B. Presence of Sp1 in the complex binding to RCE1. Nuclear extracts were prepared as above from non-treated (lanes 1, 4, 7), LY294002-treated (lanes 2, 5, 8), or LY294002-treated, washed, and allowed 5 h to recover (lanes 3, 6, 9) PC3 cells. Nuclear extracts were either incubated with no antibody, anti-Sp1 antibodies (lanes 4–6), or normal rabbit IgG (lanes 7–9) before the addition of the labeled Fra-1 RCE1 probe. The reaction mixtures were then analyzed as described above and the positions of the oligonucleotide complexes are indicated as C1, C2, and C3.

 
Since prior studies have shown that Sp1 can bind to RCE sites in the promoter regions of other genes (22–24), we tested whether the complex which bound to RCE1 contained Sp1. Addition of anti-Sp1 antibodies to the nuclear extracts before the incubation with the labeled oligonucleotide caused a supershift of the C1 complex (this new band is called C3, Fig. 7B, lanes 4–6), whereas control IgG did not cause this supershift (Fig. 7B, lanes 7–9). The amount of this supershifted complex was decreased when nuclear extracts were prepared from LY294002-treated PC3 cells and it was recovered when the LY294002-treated PC3 cells were washed and further incubated for 5 h (Fig. 7B).


    Discussion
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
In recent years, increasing evidence has implicated the PI 3-kinase/Akt pathway in the transformation of cells (1, 3). This pathway has been shown to regulate cell size, proliferation, and survival as well as tumor metastasis, angiogenesis, and invasiveness (1–3, 6–8, 25). The tumor suppressor, PTEN, has been found to be a key regulator of the PI 3-kinase/Akt by virtue of its ability to degrade PIP3 and has been shown to be mutated in a variety of human cancers. Gene amplification of both the PI 3-kinase as well as some Akt isoforms has also been shown to contribute to the formation of certain tumors. Finally, many growth factors and their receptors (including members of the EGF as well as insulin-like growth factor families) have been shown to induce the PI 3-kinase pathway.

Consequently, numerous studies have sought to identify the key targets of the PI 3-kinase/Akt pathway. A variety of proteins have been identified which are direct targets of the Akt protein kinase and the phosphorylation of these proteins may contribute to the ability of this enzyme to regulate cellular proliferation and survival. In addition, the PI 3-kinase/Akt pathway also appears to regulate gene transcription. To identify such potential targets, gene profiling has been performed in cells overexpressing Akt or in tumor cells lacking PTEN after re-introduction of this enzyme (26–28). These approaches have the potential problem that they require a longer incubation time to allow for the expression of the introduced enzymes and thus one may miss transiently activated or inactivated genes as well as identify genes the activation or inhibition of which represent a secondary event. Alternatively, one may use regulatable versions of PI 3-kinase or Akt which can be rapidly turned on (29). However, this approach can only be performed in cells which have low levels of basal Akt kinase activity to begin with.

In the present work, we describe the application of an alternative approach. In the current strategy, cells lacking PTEN (and consequently having a high basal Akt activity) are treated with a reversible inhibitor of PI 3-kinase, LY294002 (16). This treatment was found to almost completely suppress the elevated basal activity of Akt in these cells. Moreover, the removal of this inhibitor resulted in a rapid (within 5 min) activation of the Akt kinase activity in these cells. Thus, this procedure can be used to attempt to identify novel substrates of Akt as well as to identify genes the transcription of which is directly regulated by the PI 3-kinase/Akt pathway.

In the present study, we have applied this approach to identify genes the transcription of which is regulated by the PI 3-kinase/Akt pathway in the context of the prostate cancer cell line PC3. A screen of 17,083 genes by microarray analysis identified 6 genes which were consistently induced more than 2-fold after 2 h and 5 genes the levels of which were consistently decreased more than 2-fold at this time. Two of the induced genes were selected for follow up analyses, CYP1B1 and Fra-1. The former is a member of the family of P450-containing enzymes which has been proposed to play a role in the metabolism and activation of various environmental carcinogens (30). Fra-1 is a member of the Fos family of transcription factors (31). It has been previously demonstrated to be induced by insulin, serum, retinoic acid, the human T-cell leukemia virus, as well as by ß-catenin (21, 31–34). Although Fra-1 does not possess transforming activity in focus formation assays (35), it can promote anchorage-independent growth in vitro, tumor development in athymic mice, motility, and invasiveness (36, 37). In addition, increased levels of Fra-1 have been observed in neoplastic thyroid disease and has been shown to predict the aggressiveness of breast cancer cells (38, 39).

Attempts to demonstrate direct activation of a CYP1B1 reporter construct by active Akt were unsuccessful although a control of a CYP1B1 inducer (TCDD) did stimulate transcription of this construct. These results could indicate that another downstream target of the PI 3-kinase pathway is responsible for the increase in CYP1B1 mRNA in the PC3 cells after removal of the LY294002. Alternatively, it is possible that the reporter construct is missing the region of the CYP1B1 which is regulated by Akt. Attempts to distinguish between these two possibilities by transfections into the PC3 cells failed due to the low level of expression in these cells. In contrast to these results with the CYP1B1 reporter construct, active Akt3 was found to induce a Fra-1 reporter construct 4- to 6-fold, an amount which is consistent with the increase in Fra-1 mRNA levels observed in the PC3 cells after removal of LY294002. In contrast, an inactive mutant of Akt3 did not induce this reporter construct but instead actually appeared to decrease its basal level of transcription. Because all cells contain a basal level of active Akt, it is possible that this inactive Akt3 construct is acting as a functional dominant negative. The inhibitor of PI 3-kinase LY294002 also lowered the basal levels of transcription of this reporter construct. Quite surprising was the finding that expression of high levels of Akt1 also suppressed the expression of this reporter construct. This finding is, however, consistent with the ability of Akt1 to feedback and inhibit a number of biological responses (20).

The region of the Fra-1 promoter that is responsible for its stimulation by Akt3 was mapped to a region between -161 and -105 nt from the start site of transcription of Fra-1. This region contains a RCE (RCE1) which has previously been identified as contributing to the regulation of Fra-1 by serum and the Tax1 protein of human T-cell leukemia virus (21). In the present work, we have demonstrated that RCE1 also plays a key role in the induction of transcription of the Fra-1 reporter construct by Akt3. Moreover, we have been able to show that nuclear extracts from cells treated with the PI 3-kinase inhibitor LY294002 exhibit a decreased ability to shift an oligonucleotide containing this RCE and that this activity returns in nuclear extracts from cells that have been allowed to recover after removal of the inhibitor. Because prior studies have implicated Sp1 as one of the components able to bind to the RCE (22–24), we also examined whether this molecule was part of the complex that was regulated by PI 3-kinase. A supershift of this PI 3-kinase-dependent complex was demonstrated by the addition of anti-Sp1 antibodies to the nuclear extracts. Because prior studies have indicated that insulin can regulate Sp1 activity through either phosphorylation or heterodimerization with other factors like Sp3 or the retinoblastoma protein (40), it is possible that this is how Akt is inducing transcription of Fra-1.

An analysis of the promoter of two other genes (CYP1B1 and PTGS2) which are up-regulated on LY294002 withdrawal did not reveal any RCE sites. This is consistent with the lack of regulation of the CYP1B1 with the co-transfection with Akt. In the case of PTGS2, Akt has been recently shown to regulate the stability of its mRNA (41), and this could result in the observed increase in its mRNA in the present studies. In addition, we did not observe an increase in some other genes with a RCE (e.g., MN/CN 9), consistent with prior studies indicating that RCEs can be regulated in a cell type-specific manner (42).

In conclusion, the present studies demonstrate that Akt3 can induce Fra-1 gene transcription. Although prior studies had implicated other signaling pathways (i.e., ERK) in the induction of Fra-1 (43), Akt had not previously been identified as playing a role in this process. Because Fra-1 has been shown to contribute to the progression of certain cancers (including thyroid and breast), it is possible that this is another mechanism whereby activation of Akt can contribute to tumor formation and/or the progression of a particular cancer.


    Materials and Methods
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Materials
Cell culture media, RT-PCR kit, random priming kit, and the restriction endonucleases were from Life Technologies, Inc. (Gaithersburg, MD). Total RNA was isolated using the RNeasy kit from Qiagen (Chatsworth, CA) and the poly(A)+ fraction was isolated with the FastTrack 2.0 kit (Invitrogen, Carlsbad, CA). [{gamma}-32P]ATP (3000 Ci/mmol) and [{alpha}-32P]dCTP (3000 Ci/mmol) were from NEN Life Science Products, Boston, MA. Anti-HA monoclonal antibody and Fugene6 transfection reagent were from Roche Molecular Biochemicals, Indianapolis, IN. Rabbit polyclonal anti-Fra-1 and anti-Sp1 antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Hybond nylon membrane and horseradish peroxidase conjugated to donkey anti-rabbit IgG or anti-mouse IgG were from Amersham Biosciences (Amersham, United Kingdom). Luciferase reporter vector pGL3, pCMVRL, and the Dual-Luciferase reporter assay kit were from Promega (Madison, WI). The CYP1B1 reporter construct was a kind gift of Dr. William Greenlee (CIIT, Research Triangle Park, NC) (18). The constitutively active Akt1 and Akt3 plasmids (myrAkt1 and myrAkt3 in pcDNA3.1) were as previously described (19, 44). To construct the kinase dead myrAkt3, the active site lysine was changed to methionine by base substitution using the Quickchange site-directed mutagenesis kit (Stratagene, Cedar Creek, TX).

Plasmids
The Fra-1 promoter (bases -749 to +23 bp relative to the transcription start site) was amplified by PCR from genomic DNA isolated from PC3 cells (sense primer: GGCAATACGGCGAGACCC, antisense primer: GTACACGGCTGCTGGGTTCTG). The resulting PCR product was cloned into pGL3 basic luciferase reporter vector (Promega) to generate plasmid pFra1. 5' Deletion mutants of the Fra-1 promoter were amplified by PCR with specific primers and were placed back into the pGL3 basic vector. Base substitution mutations were made for RCEs and the SREs by using Quickchange site-directed mutagenesis kit (Stratagene) and specific primers. The sequence of the SRE was changed from CCAAGTTCGGG to CGCGGTTCGCG, RCE1 was changed from GGGGGTGG to GGCGCTCG, and RCE2 was changed from CCCCCACCCCC to CCCCGAGCGCC.

Microarray Analyses
PC3 cells were treated with 30 µM LY294002 overnight, washed, and then incubated for 2, 6, or 10 h in the absence of the drug. Cells were then lysed, poly(A)+ RNA isolated, reverse transcribed, labeled, and hybridized to microarrays as described (45). The arrays contained 22,648 different human cDNAs representing 17,083 different UniGene clusters. Hybridized arrays were imaged using a Genpix 4000 scanner and the data are available at: http://genome-www5.stanford.edu/MicroArray/SMD/.

Akt Enzyme Assays
PC3 cells were maintained in a humidified atmosphere of 5% CO2 in RPMI 1640 supplemented with 5% fetal bovine serum, 100 µg/ml streptomycin, and 100 units/ml penicillin. Cells were serum starved and treated overnight with 30 µM LY294002 and then lysed in 1 ml lysis buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM DTT, 1 mM benzamidine, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na3VO4, 30 mM NaPPi, 10 mM NaF, 100 nM okadaic acid]. Lysates were centrifuged for 15 min at 15,000 x g and immunoprecipitated for 2 h at 4°C with 2.5 µl of anti-Akt3 antibody. Immunoprecipitates were washed three times with the lysis buffer and twice with the kinase assay buffer [50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 µM DTT] and assayed using GSK-3 (GRPRTSSFAEG) peptide as substrate as described (46). Following the kinase reaction, the phosphorylated peptide was separated from unincorporated [{gamma}-32P]ATP on a 40% polyacrylamide gel containing 6% urea. The phosphopeptide spots were excised and counted.

RT-PCR and Northern Blot Analysis
Total RNA was isolated from LY294002-treated PC3 cells using RNeasy kit (Qiagen). First strand cDNA was synthesized from 1 to 5 µg total RNA with random primers and Superscript II reverse transcriptase (Life Technologies). The forward and reverse primers for amplification of human Fra-1 were based on the human Fra-1 sequence (Genbank accession no. NM005438). The conditions used for amplification were: 94°C for 1 min followed by 55°C for 1 min and 72°C for 1 min. For Northern blot analyses, 10 µg RNA were denatured and separated on 1% formaldehyde/agarose gels. The RNA was transferred to nylon membranes by capillary action overnight using 20x SSC and cross-linked by UV light (1200 J/cm2, Stratalinker). The blots were probed at 42°C overnight with a random primed 32P-labeled probe of human Fra-1 cDNA as described (47).

Western Blotting
PC3 cells, treated as indicated, or transiently transfected MCF-7 cells were washed in ice-cold PBS and then lysed by scraping in 500 µl of lysis buffer (as described above). After centrifugation at 15,000 x g for 30 min, the supernatants were resolved on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes. Fra-1 and Akt3 were detected by Western blotting with anti-Fra-1 (1:1000) and anti-HA (1:1000) antibodies, respectively.

Cell Transfections and Reporter Gene Assays
MCF-7 cells were grown to 70% confluence in six-well plates. The cells were incubated for 15 min with a mixture of 5 ng of pRLCMV, 0.5 µg of the indicated Akt construct (or its empty vector, pcDNA3.1), and 0.5 µg of pFra-luc construct and Fugene6 reagent (Roche Molecular Biochemicals) using a ratio of 3 µl of Fugene6 reagent per microgram of plasmid DNA in serum-free media, according to the manufacturer's instructions. After 48 h of transfection, the cells were washed twice in ice-cold PBS, extracted in passive lysis buffer (Promega) and assayed sequentially for the firefly luciferase and Renilla luciferase activities, according to the manufacturer's instructions.

Electrophoretic Mobility Shift Assays
Nuclear extracts were prepared from PC3 cells as described (48). Electrophoretic mobility shift assays (EMSAs) were performed using DIG gel shift kit (Roche), according to the manufacturer's instructions. Binding reactions contained 4 µl binding buffer (Roche), 5 µg nuclear extracts, 0.4 ng of digoxigenin-labeled probe, 1 µg poly(dI·dc), 1 µg poly L-lysine in a total reaction volume of 20 µl. Oligonucleotides, RCE1 (GCGCGTCTCGGGGGTGGAGCCTGGAGG), its mutant (GCGCGTCTCGGCGCTCGAGCCTGGAGG), and RCE2 (GCAACGCCCCCACCCCCCGCGGTCGCA) were labeled at the 3' end with digoxigenin-11-ddUTP. For competition experiments, 125-fold molar excess of unlabeled oligonucleotide was added to the reaction mixture before the addition of the probe. For super shift assays, anti-Sp1 antibody was pre-incubated with the nuclear extracts for 1 h at 4°C before the initiation of the binding reaction. Mobility shift reactions were resolved on 6% nondenaturing polyacrylamide gels for 3 h at 100 V. Following the electrophoretic separation, the complexes were transferred to nylon membrane by contact blotting and visualized by enzyme immunoassay using anti-Digoxigenin-alkaline phosphatase antibody and chemiluminescent alkaline phosphatase substrate.


    Acknowledgements
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
We thank Dr. Daisy De Leon (Loma Linda University) for the MCF-7 cells used in these studies, Dr. William Greenlee for the CYP1B1 reporter construct, and Dr. Jon Horowitz for Sp1 constructs.


    Notes
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
1 Pfeiffer Foundation Grant and a DOD Grant DAMD 17-00-1-04445 (to R.A.R.); a fellowship from a NIH Diabetes, Endocrinology and Metabolism Training Grant (NIH DK07217) (to G.T.); an American Diabetes Association mentor Based postdoctoral fellowship (to H.S.); and the HHMI and National Cancer Institute Grant 5U01 CA85129 (to J.R.P.). Back

Received December 16, 2002; revised February 12, 2003; accepted February 28, 2003.


    References
 Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 

  1. Vivanco, I. and Sawyers, C. L. The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat. Rev. Cancer, 2: 489–501, 2002.[Medline]
  2. Cantley, L. C. The phosphoinositide 3-kinase pathway. Science, 296: 1655–1657, 2002.[Abstract/Free Full Text]
  3. Waite, K. A. and Eng, C. Protean PTEN: form and function. Am. J. Hum. Genet., 70: 829–844, 2002.[Medline]
  4. Maehama, T. and Dixon, J. E. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J. Biol. Chem., 273: 13375–13378, 1998.[Abstract/Free Full Text]
  5. Lawlor, M. A. and Alessi, D. R. PKB/Akt: a key mediator of cell proliferation, survival and insulin responses? J. Cell Sci., 114: 2903–2910, 2001.
  6. Coffer, P. J., Jin, J., and Woodgett, J. R. Protein kinase B (c-Akt): a multifunctional mediator of phosphatidylinositol 3-kinase activation. Biochem. J., 335: 1–13, 1998.
  7. Brazil, D. P. and Hemmings, B. A. Ten years of protein kinase B signalling: a hard Akt to follow. Trends Biochem. Sci., 26: 657–664, 2001.[Medline]
  8. Brunet, A., Datta, S. R., and Greenberg, M. E. Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Cur. Opin. Neurobiol., 11: 297–305, 2001.[Medline]
  9. Czech, M. P. PIP2 and PIP3: complex roles at the cell surface. Cell, 100: 603–606, 2000.[Medline]
  10. McManus, E. J. and Alessi, D. R. TSC1-TSC2: a complex tale of PKB-mediated S6K regulation. Nat. Cell Biol., E2: 14–16, 2002.
  11. Berwick, D. C., Hers, I., Heesom, K. J., Moule, S. K., and Tavare, J. M. The Identification of ATP-citrate lyase as a protein kinase B (Akt) substrate in primary adipocytes. J. Biol. Chem., 277: 33895–33900, 2002.[Abstract/Free Full Text]
  12. Kane, S., Sano, H., Liu, S. C., Asara, J. M., Lane, W. S., Garner, C. C., and Lienhard, G. E. A method to identify serine kinase substrates. Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating protein (GAP) domain. J. Biol. Chem., 277: 22115–22118, 2002.[Abstract/Free Full Text]
  13. Kohn, A. D., Barthel, A., Kovacina, K. S., Boge, A., Wallach, B., Summers, S. A., Birnbaum, M. J., Scott, P. H., Lawrence J. C., Jr., and Roth, R. A. Construction and characterization of a conditionally active version of the serine/threonine kinase Akt. J. Biol. Chem., 273: 11937–11943, 1998.[Abstract/Free Full Text]
  14. Klippel, A., Escobedo, M. A., Wachowicz, M. S., Apell, G., Brown, T. W., Giedlin, M. A., Kavanaugh, W. M., and Williams, L. T. Activation of phosphatidylinositol 3-kinase is sufficient for cell cycle entry and promotes cellular changes characteristic of oncogenic transformation. Mol. Cell. Biol., 18: 5699–5711, 1998.[Abstract/Free Full Text]
  15. Whang, Y. E., Wu, X., Suzuki, H., Reiter, R. E., Tran, C., Vessella, R. L., Said, J. W., Isaacs, W. B., and Sawyers, C. L. Inactivation of the tumor suppressor PTEN/MMAC1 in advanced human prostate cancer through loss of expression. Proc. Natl. Acad. Sci. USA, 95: 5246–5250, 1998.[Abstract/Free Full Text]
  16. Vlahos, C. J., Matter, W. F., Hui, K. Y., and Brown, R. F. A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J. Biol. Chem., 269: 5241–5248, 1994.[Abstract/Free Full Text]
  17. Nakatani, K., Thompson, D. A., Barthel, A., Sakaue, H., Liu, W., Weigel, R. J., and Roth, R. A. Up-regulation of Akt3 in estrogen receptor-deficient breast cancers and androgen-independent prostate cancer lines. J. Biol. Chem., 274: 21528–21532, 1999.[Abstract/Free Full Text]
  18. Shehin, S. E., Stephenson, R. O., and Greenlee, W. F. Transcriptional regulation of the human CYP1B1 gene. Evidence for involvement of an aryl hydrocarbon receptor response element in constitutive expression. J. Biol. Chem., 275: 6770–6776, 2000.[Abstract/Free Full Text]
  19. Kohn, A. D., Takeuchi, F., and Roth, R. A. Akt, a pleckstrin homology domain containing kinase, is activated primarily by phosphorylation. J. Biol. Chem., 271: 21920–21926, 1996.[Abstract/Free Full Text]
  20. Andersen, C. B., Sakaue, H., Nedachi, T., Kovacina, K. S., Clayberger, C., Conti, M., and Roth, R. A. Protein kinase B/Akt is essential for the insulin but not progesterone-stimulated resumption of meiosis in Xenopus oocytes. Biochem. J., 369: 227–238, 2002.
  21. Tsuchiya, H., Fujii, M., Niki, T., Tokuhara, M., Matsui, M., and Seiki, M. Human T-cell leukemia virus type 1 Tax activates transcription of the human fra-1 gene through multiple cis elements responsive to transmembrane signals. J. Virol., 67: 7001–7007, 1993.[Abstract/Free Full Text]
  22. Yamabe, Y., Shimamoto, A., Goto, M., Yokota, J., Sugawara, M., and Furuichi, Y. Sp1-mediated transcription of the Werner helicase gene is modulated by Rb and p53. Mol. Cell. Biol., 18: 6191–6200, 1998.[Abstract/Free Full Text]
  23. Udvadia, A. J., Rogers, K. T., Higgins, P. D., Murata, Y., Martin, K. H., Humphrey, P. A., and Horowitz, J. M. Sp-1 binds promoter elements regulated by the RB protein and Sp-1-mediated transcription is stimulated by RB coexpression. Proc. Natl. Acad. Sci. USA, 90: 3265–3269, 1993.[Abstract/Free Full Text]
  24. Udvadia, A. J., Templeton, D. J., and Horowitz, J. M. Functional interactions between the retinoblastoma (Rb) protein and Sp-family members: superactivation by Rb requires amino acids necessary for growth suppression. Proc. Natl. Acad. Sci. USA, 92: 3953–3957, 1995.[Abstract/Free Full Text]
  25. Leslie, N. R. and Downes, C. P. PTEN: the down side of PI 3-kinase signalling. Cell. Signal., 14: 285–295, 2002.[Medline]
  26. Cook, S. A., Matsui, T., Li, L., and Rosenzweig, A. Transcriptional effects of chronic Akt activation in the heart. J. Biol. Chem., 277: 22528–22533, 2002.[Abstract/Free Full Text]
  27. Matsushima-Nishiu, M., Unoki, M., Ono, K., Tsunoda, T., Minaguchi, T., Kuramoto, H., Nishida, M., Satoh, T., Tanaka, T., and Nakamura, Y. Growth and gene expression profile analyses of endometrial cancer cells expressing exogenous PTEN. Cancer Res., 61: 3741–3749, 2001.[Abstract/Free Full Text]
  28. Stolarov, J., Chang, K., Reiner, A., Rodgers, L., Hannon, G. J., Wigler, M. H., and Mittal, V. Design of a retroviral-mediated ecdysone-inducible system and its application to the expression profiling of the PTEN tumor suppressor. Proc. Natl. Acad. Sci. USA, 98: 13043–13048, 2001.[Abstract/Free Full Text]
  29. Kuhn, I., Bartholdi, M. F., Salamon, H., Feldman, R. I., Roth, R. A., and Johnson, P. H. Identification of AKT-regulated genes in inducible MERAkt cells. Physiol. Genomics, 7: 105–114, 2001.[Abstract/Free Full Text]
  30. Murray, G. I., Melvin, W. T., Greenlee, W. F., and Burke, M. D. Regulation, function, and tissue-specific expression of cytochrome P450 CYP1B1. Annu. Rev. Pharmacol. Toxicol., 41: 297–316, 2001.[Medline]
  31. Cohen, D. R. and Curran, T. fra-1: a serum-inducible, cellular immediate-early gene that encodes a fos-related antigen. Mol. Cell. Biol., 8: 2063–2069, 1988.[Abstract/Free Full Text]
  32. Griffiths, M. R., Black, E. J., Culbert, A. A., Dickens, M., Shaw, P. E., Gillespie, D. A., and Tavare, J. M. Insulin-stimulated expression of c-fos, fra1 and c-jun accompanies the activation of the activator protein-1 (AP-1) transcriptional complex. Biochem. J., 335: 19–26, 1998.
  33. Mann, B., Gelos, M., Siedow, A., Hanski, M. L., Gratchev, A., Ilyas, M., Bodmer, W. F., Moyer, M. P., Riecken, E. O., Buhr, H. J., and Hanski, C. Target genes of ß-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal carcinomas. Proc. Natl. Acad. Sci. USA, 96: 1603–1608, 1999.[Abstract/Free Full Text]
  34. Kaiser, A., Brembeck, F. H., v Marschall, Z., Riecken, E. O., Wiedenmann, B., and Rosewicz, S. Fra-1: a novel target for retinoid action. FEBS Lett., 448: 45–48, 1999.[Medline]
  35. Wisdom, R. and Verma, I. M. Proto-oncogene FosB: the amino terminus encodes a regulatory function required for transformation. Mol. Cell. Biol., 13: 2635–2643, 1993.[Abstract/Free Full Text]
  36. Bergers, G., Graninger, P., Braselmann, S., Wrighton, C., and Busslinger, M. Transcriptional activation of the fra-1 gene by AP-1 is mediated by regulatory sequences in the first intron. Mol. Cell. Biol., 15: 3748–3758, 1995.[Abstract]
  37. Kustikova, O., Kramerov, D., Grigorian, M., Berezin, V., Bock, E., Lukanidin, E., and Tulchinsky, E. Fra-1 induces morphological transformation and increases in vitro invasiveness and motility of epithelioid adenocarcinoma cells. Mol. Cell. Biol., 18: 7095–7105, 1998.[Abstract/Free Full Text]
  38. Zajchowski, D. A., Bartholdi, M. F., Gong, Y., Webster, L., Liu, H. L., Munishkin, A., Beauheim, C., Harvey, S., Ethier, S. P., and Johnson, P. H. Identification of gene expression profiles that predict the aggressive behavior of breast cancer cells. Cancer Res., 61: 5168–5178, 2001.[Abstract/Free Full Text]
  39. Chiappetta, G., Tallini, G., De Biasio, M. C., Pentimalli, F., de Nigris, F., Losito, S., Fedele, M., Battista, S., Verde, P., Santoro, M., and Fusco, A. FRA-1 expression in hyperplastic and neoplastic thyroid diseases. Clin. Cancer Res., 6: 4300–4306, 2000.[Abstract/Free Full Text]
  40. Samson, S. L. and Wong, N. C. Role of Sp1 in insulin regulation of gene regulation. J. Mol. Endocrinol., 29: 265–279, 2002.[Abstract]
  41. Sheng, H., Shao, J., and Dubois, R. N. K-Ras-mediated increase in cyclooxygenase 2 mRNA stability involves activation of the protein kinase B1. Cancer Res., 61: 2670–2675, 2001.[Abstract/Free Full Text]
  42. Kim, S. J., Lee, H. D., Robbins, P. D., Busam, K., Sporn, M. B., and Roberts, A. B. Regulation of transforming growth factor ß 1 gene expression by the product of the retinoblastoma-susceptibility gene. Proc. Natl. Acad. Sci. USA, 88: 3052–3056, 1991.[Abstract/Free Full Text]
  43. Hurd, T. W., Culbert, A. A., Webster, K. J., and Tavare, J. M. Dual role for mitogen-activated protein kinase (Erk) in insulin-dependent regulation of Fra-1 (fos-related antigen-1) transcription and phosphorylation. Biochem. J., 368: 573–580, 2002.[Medline]
  44. Nakatani, K., Sakaue, H., Thompson, D. A., Weigel, R. J., and Roth, R. A. Identification of a human Akt3 (protein kinase B {gamma}) which contains the regulatory serine phosphorylation site. Biochem. Biophys. Res. Commun., 257: 906–910, 1999.[Medline]
  45. Perou, C. M., Sorlie, T., Eisen, M. B., van de Rijn, M., Jeffrey, S. S., Rees, C. A., Pollack, J. R., Ross, D. T., Johnsen, H., Akslen, L. A., Fluge, O., Pergamenschikov, A., Williams, C., Zhu, S. X., Lonning, P. E., Borresen-Dale, A. L., Brown, P. O., and Botstein, D. Molecular portraits of human breast tumours. Nature, 406: 747–752, 2000.[Medline]
  46. Cross, D. A. E., Alessi, D. R., Cohen, P., Andjelkovich, M., and Hemmings, B. A. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature, 378: 785–789, 1995.[Medline]
  47. Thompson, D. A. and Weigel, R. J. Characterization of a gene that is inversely correlated with estrogen receptor expression (ICERE-1) in breast carcinomas. Eur. J. Biochem., 252: 169–177, 1998.[Medline]
  48. Andrews, N. C. and Faller, D. V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res., 19: 2499, 1991.[Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Q. Zhang, P. Adiseshaiah, D. V. Kalvakolanu, and S. P. Reddy
A Phosphatidylinositol 3-Kinase-regulated Akt-Independent Signaling Promotes Cigarette Smoke-induced FRA-1 Expression
J. Biol. Chem., April 14, 2006; 281(15): 10174 - 10181.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Cao, N. Dronadula, and G. N. Rao
Thrombin induces expression of FGF-2 via activation of PI3K-Akt-Fra-1 signaling axis leading to DNA synthesis and motility in vascular smooth muscle cells
Am J Physiol Cell Physiol, January 1, 2006; 290(1): C172 - C182.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W. Wollmann, M. L. Goodman, P. Bhat-Nakshatri, H. Kishimoto, R. J. Goulet Jr, S. Mehrotra, A. Morimiya, S. Badve, and H. Nakshatri
The macrophage inhibitory cytokine integrates AKT/PKB and MAP kinase signaling pathways in breast cancer cells
Carcinogenesis, May 1, 2005; 26(5): 900 - 907.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. T. Lee Jr., L. S. Steelman, and J. A. McCubrey
Phosphatidylinositol 3'-Kinase Activation Leads to Multidrug Resistance Protein-1 Expression and Subsequent Chemoresistance in Advanced Prostate Cancer Cells
Cancer Res., November 15, 2004; 64(22): 8397 - 8404.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tiwari, G.
Right arrow Articles by Roth, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tiwari, G.
Right arrow Articles by Roth, R. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation