Molecular Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Bridging the Lab and the Clinic in Cancer Medicine
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hernandez, I.
Right arrow Articles by Greenberg, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hernandez, I.
Right arrow Articles by Greenberg, N. M.
Molecular Cancer Research 1:1036-1047 (2003)
© 2003 American Association for Cancer Research

Cancer Genes and Genomics

Prostate-Specific Expression of p53R172L Differentially Regulates p21, Bax, and mdm2 to Inhibit Prostate Cancer Progression and Prolong Survival1

Inmaculada Hernandez1,3, Lisette A. Maddison1, Yongli Wei1, Francesco DeMayo1, Tobias Petras4, Baolin Li5, Jeffrey R. Gingrich6, Jeffrey M. Rosen1 and Norman M. Greenberg1,2

1 Department of Molecular and Cellular Biology and 2 Scott Department of Urology, Baylor College of Medicine, Houston, TX; 3 Department of Biochemistry, Molecular Biology and Physiology, University of Las Palmas de Gran Canaria, Las Palmas, Spain; 4 Department of Urology, Humboldt-University, Berlin, Germany; 5 Neuroscience Division, Lilly Laboratory, Indianapolis, IN; and 6 Department of Urology, University of Pittsburgh, Pittsburgh, PA

Requests for reprints: Norman M. Greenberg, Clinical Research Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N., D4-197, Seattle, WA 98109-1024. Phone: (206) 667-4433, Fax: (206) 667-4930. Email: normang{at}fhcrc.org


   Abstract
Top
 Notes
 Abstract
Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Loss of heterozygosity or mutation at the p53 tumor suppressor gene locus is frequently associated with advanced human prostate cancer. Hence, replacement p53 gene therapy may prove to be efficacious for this disease. While many mutations result in p53 molecules with oncogenic properties, other variants may possess wild-type properties with increased tumor suppressor activity. We have chosen to investigate the activity of a naturally occurring variant p53 molecule, p53R172L, carrying an arginine-to-leucine mutation at codon 172. We demonstrate that p53R172L can differentially activate expression of genes involved in cell cycle control and apoptosis in vitro. Transgenic mice expressing a subphysiological level of a p53R172L minigene (PB-p53R172L) in the prostate epithelium were generated and bred to the transgenic adenocarcinoma mouse prostate (TRAMP) model of prostate cancer. While PB-p53R172L transgenic mice developed normally with no detectable prostate gland phenotype, we observed a significant increase in the apoptotic index in the prostate glands of TRAMP x PB-p53R172L F1 mice. We noted an increase in the expression of Bax in the bigenic mice concomitant with the reduced incidence and rate of tumor growth and increased survival. While low-level expression of the p53R172L variant had no obvious influence on normal prostate tissue, it was able to significantly inhibit prostate cancer progression in the context of a genetically predisposed model system. This suggests that additional tumor-related events specifically influence the ability of the variant p53R172L molecule to inhibit tumor growth. These studies support gene therapy strategies employing specific p53 variants.


   Introduction
Top
 Notes
 Abstract
 Introduction
Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
Prostate cancer is the second leading cause of cancer death in men in the United States with over 28,000 deaths predicted in 2003 (1). Several studies have demonstrated significant incidence of mutations in p53 in advanced prostate cancer (2–4), and p53 mutations have been suggested to occur frequently in early stages of prostate cancer (5). Loss and mutation of p53 has also been described for metastatic prostate cancer (6–8) and in association with the emergence of the androgen-independent phenotype (9–11). These data support the hypothesis that abrogation of a normal pattern of functional p53 expression is an important event in prostate cancer progression (12) and suggests that specific strategies could be designed to exploit the p53-independent nature of advanced prostate cancer (13).

The p53 tumor suppressor gene mediates cellular responses to events such as DNA damage, hypoxia, mitotic spindle damage, and expression of activated oncogenes (14–16) through the initiation of growth arrest or cell death pathways and is generally believed to prevent the accumulation and propagation of genetic aberrations (17). Functionally, p53 is a sequence-specific transcription factor that binds to the upstream regulatory region of genes such as the cyclin-dependent kinase inhibitor WAF-1/p21 (18), 14-3-3s (19), and Bax (20). In addition, p53 has been shown to down-regulate prostate-specific antigen, a marker used in the diagnosis of prostate cancer (21). One important p53 target gene is mdm2, which in turn binds to p53 and facilitates ubiquitin-mediated p53 degradation (22–24).

In human cancer, wild-type p53 expression is often abrogated by somatic mutation. In fact, over 50% of human tumors carry mutations in the p53 gene, with the majority being single-base substitutions. The majority of p53 mutations occur in the DNA-binding domain (25) with hotspots for mutation at codons 175, 248, and 282 resulting in alterations in DNA binding (26). In general, mutations in p53 abrogate normal function and extend the half-life of the protein. More specifically, some p53 mutations act in a dominant-negative fashion to block normal p53 function (27) while other mutations may impart a gain of function (28) resulting in up-regulation of nonclassical p53-regulated genes such as multidrug resistance and epidermal growth factor receptor (reviewed in Ref. 29). Mutant p53 molecules often act as oncogenes, and p53 proteins carrying missense mutations may impart significant growth advantage or aggressive metastatic potential (6–8). Adding complexity to the spectrum of p53 mutation, individual mutations may result in specific cellular responses (30). Among the range of mutations, p53 carrying an arginine-to-histidine mutation at codon 175 (p53R175H) has been detected at high frequency in aggressive breast cancers and has been demonstrated to impart a predisposition to transformation in transgenic mice (31–34).

In contrast to oncogenic mutations of p53, mutated forms of p53 with wild-type properties have also been identified in human tumors. A mutation in p53 resulting in an arginine-to-leucine substitution at codon 175 (p53R175L) has been identified in several breast cancer biopsies (35) as well as frequently in lung (36–38) and colon (39, 40) carcinoma. In contrast to the p53R175H mutation, p53R175L is not transforming (41, 42). In fact, p53R175L has many properties consistent with wild-type p53 including the ability to recognize p53-specific DNA-binding sequences, to modulate the expression of genes known to be regulated by wild-type p53, and to inhibit cell growth (43). Furthermore, transgenic mice that overexpress a murine p53R172L (analogous to human p53R175L) in the mammary gland exhibit increased apoptosis in the mammary gland and significant decrease in the incidence of 7,12-dimethylbenz(a)anthracene-induced mammary tumors (42).

Translational prostate cancer research and the ability to validate the efficacy of candidate therapeutic regimens in preclinical trials have been hampered by the paucity of well-defined relevant in vivo tumor models. The transgenic adenocarcinoma mouse prostate (TRAMP) model was developed using the minimal rat probasin promoter to express the SV40 early genes (T/t antigen: Tag) specifically in the epithelial cells of the mouse prostate (44, 45). Male TRAMP mice develop progressive prostate disease that histologically and pathologically mimics human disease with metastatic spread to distant sites (46, 47), making the TRAMP model a useful model for preclinical evaluation of therapeutic strategies.

We show in this study that p53R172L can discriminate among the intrinsic response elements of p21, mdm2, and Bax in vivo and can increase expression of WAF-1/p21 and mdm2 promoter-based reporter constructs 2–5-fold over wild-type p53. Based on these observations, we established transgenic mice that carry a p53R172L fusion minigene (PB-p53R172L) and demonstrate subphysiological level of p53R172L expression in prostate epithelium. The mice develop normally with no detectable changes in prostate gland cellular architecture, morphology, wet weight, proliferation, or apoptotic indices. However, when PB-p53R172L transgenic mice were crossed to TRAMP mice, there was a reduction in tumor progression and rate of tumor growth with a significant increase in survival associated with p21 expression and Bax-mediated tumor-specific apoptosis. Therefore, this study demonstrates that a specific variant p53 molecule does not perturb normal cell growth and development yet can dramatically inhibit tumor progression. Our data suggest that variants such as p53R172L may prove useful in treating prostate cancer.


   Results
Top
 Notes
 Abstract
 Introduction
 Results
Discussion
 Materials and Methods
 Acknowledgements
 References
 
Characterization of p53R172L
One of the major biochemical functions of wild-type 53 is the ability to act as a sequence-specific transcriptional factor (48). As mutated forms of p53 may differentially influence transcription of target genes (49), we investigated the abilities of wild-type p53 and p53R172L to activate expression of specific gene reporter constructs. For this analysis, expression plasmids carrying either wild-type p53 or p53R172L were introduced into p53-null fibroblasts (a generous gift of Dr. G. Lozano) along with WAF-1/p21-luc, Bax-luc, or mdm2-luc reporter plasmids (a generous gift of Dr. M. Oren). Luciferase activity was used to measure p53-mediated transcriptional activity, and immunoblotting was used to normalize transfection data to levels of expressed p53 protein. As the large tumor antigen (Tag) of SV40 can bind to and abrogate the function of wild-type p53 (50), transcriptional activities of both wild-type p53 and p53R172L were assayed in the presence of increasing amounts of Tag. As shown in Fig. 1, wild-type p53 was a better transcriptional activator of Bax-luc than p53R172L. The p53R172L variant was able to stimulate expression of the WAF-1/p21-luc and mdm2-luc reporter plasmids ~4- and 1.5-fold higher than wild-type p53, respectively. Transcriptional activity of p53R172L appeared to be more sensitive than wild-type p53 to the presence of Tag in the Bax-luc and whey acidic protein (WAP)/p21-luc transactivation assays. In general, mutated forms of p53 display half-lives greater than observed for wild-type p53. However, as shown in Fig. 1, the p53R172L variant was found by pulse-chase analysis to have a half-life of ~60 min in our system in contrast to the 135-min half-life of wild-type p53. This result is consistent with the observation that the variant p53R172L induced mdm2 transcription, a negative regulator of p53 expression, to a level greater than wild-type p53. In general, this biochemical evidence supports the hypothesis that the variant p53R172L possesses gain of function characteristics and increased transcriptional activity when assayed on classical p53-regulated promoters.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 1. Characterization of p53R172L. The p53-null mouse embryo fibroblasts were transfected with 0.5 µg of expression plasmids carrying wild-type p53 (open bars) or p53R172L (filled bars) and cotransfected with 0.1 µg Bax-luc (A), WAF-1/p21-luc (B), or mdm2-luc (C) reporter plasmids and increasing amounts (0–1.5 µg) of a SV40 early gene expression plasmid. Columns, luciferase relative units normalized to the expression level of wild-type p53 or p53R172L protein. Half-lives of wild-type p53 (empty circles) and p53R172L (full circles) were determined by [35S]-methionine/cysteine pulse-chase analysis (D). Cells transfected with 5 µg of wild-type p53 or p53R172L expression plasmids were labeled for 15 min and chased with cold methionine and cysteine for up to 3 h. Following immunoprecipitation, the label intensity was quantified by image analysis. Band intensities are expressed as a percentage of control (pulse only, no chase).

 
Expression of p53R172L in Transgenic Mice
To determine the consequence of enforced expression of p53R172L in prostate epithelial cells, transgenic mice carrying the -426/+28-bp PB promoter sequences fused to a mouse p53R172L minigene (Fig. 2A) were generated by pronuclear injection into FVB/N zygotes. Four independent founder mice were identified, and of these, line 7856 was found to express subphysiological levels of the transgene in a very tissue-restricted manner (Fig. 2B) and was therefore chosen for further study. In line 7856, transgene-specific transcripts could only be detected by reverse transcription-PCR (RT-PCR) followed by hybridization with radiolabeled probe and overnight exposure to X-ray film (Fig. 2C). This is in contrast to the 5–10-min exposure required to detect endogenous p53 in parallel reactions despite similar primer efficiency (Fig. 2D). The ratio of PB-p53R172L transgene expression to endogenous p53 expression was determined to be ~1–50. It is important to note, however, that profound phenotypes have been observed in mice where the level of expression of a mutant p53 molecule was substantially lower than levels of wild-type p53 (51).



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 2. Generation of PB-p53R172L transgenic mice. A. Representation of the PB-p53R172L transgene carrying the -426/+28-bp rat probasin promoter, the murine p53R172L genomic DNA (exons 2–11 and introns 2–9), and the SV40 polyadenylation signals. The arginine-to-leucine mutation is indicated at codon 172 of the minigene. Arrows, location of primer sets for screening and RT-PCR. B. RT-PCR analysis of PB-p53R172L transgene expression in different tissues. Total RNA (1 µg) extracted from tissues was subjected to 30-cycle RT-PCR and fractionated on 2% agarose gels. DNA was transferred to solid nylon support and was hybridized with a 666-bp AvaI restricted, 32P-labeled murine p53 cDNA probe. The tissues assayed are the following: pr, prostate gland; bl, bladder; ki, kidney; te, testis; lu, lung; br, brain; sp, spleen; he, heart; sv, seminal vesicle; li, liver; ap, coagulating gland. C. RT-PCR analysis of ventral (V) and dorsolateral (DL) prostate gland shows no p53R172L expression in normal mice (p53-T-). Expression of p53R172L is detected in bigenic mice (p53+T+) at levels well below endogenous p53. The exposure time for each Southern blot is indicated. The L19 internal RT-PCR control indicates equivalent amounts in each PCR reaction. D. The difference of RT-PCR detection of p53R172L versus endogenous p53 is not due to different primer efficiencies in the PCR reaction. Increasing amounts of the rat probasin promoter fused to p53 cDNA was used as a template in the RT-PCR reaction for each primer pair.

 
PB-p53R172L Transgenic Mice Display Normal Prostate Development
Histological examination of H&E sections of prostate tissues of 18-week-old mice was used to evaluate the consequence of .PB-p53R172L expression in vivo. As shown in Fig. 3, enforced expression of p53R172L in prostate epithelium was not detrimental to normal prostate gland development. The histological features of the prostate glands in PB-p53R172L mice appeared identical to those of nontransgenic littermates at 18 weeks of age (Fig. 3, A and B). The prostatic acini in PB-p53R172L transgene mice were lined by columnar secretory epithelium surrounded by scattered basal epithelial cells and a fibromuscular stroma containing three to four cell layers of smooth muscle (Fig. 3, C and D).



View larger version (124K):
[in this window]
[in a new window]
  		FIGURE 3. Analysis of prostate tissues from nontransgenic and PB-p53R172L transgenic mice. A–D. Representative sections stained with H&E. A. Section through prostate of nontransgenic male mouse demonstrates acini composed of a single layer of columnar secretory epithelium with rounded basal nuclei (x10). B. Higher magnification of section shown in A demonstrates that three to four layers of smooth muscle cells and stromal fibroblasts (x40) surround each acinus. C. Section through prostate of a PB-p53R172L transgenic mouse demonstrates histology identical to that observed in A (x10). D. Higher magnification of section shown in C demonstrates that acini in PB-p53R172L transgenic mouse are surrounded by three to four layers of fibromuscular stroma, smooth muscle cells, and stromal fibroblasts (x40) similar to nontransgenic mice. E–G. Section from nontransgenic mice analyzed by TUNEL method (E), immunohistochemistry with anti-p21 antibody (F), and immunohistochemistry with anti-BrdUrd antibody (G; x40). H–J. Sections from PB-p53R172L transgenic mice analyzed by TUNEL method (H), immunohistochemistry with anti-p21 antibody (I), and immunohistochemistry with anti-BrdUrd antibody (J; x40). Methyl green was used as counterstain. Arrows, positive cells. Black bars, 5 µm.

 
It had been demonstrated previously that p53R172L could induce apoptosis when hyperexpressed in the mammary gland of transgenic mice (42); therefore, the level of apoptosis in prostate tissues from nontransgenic and PB-p53R172L transgenic mice was determined. As shown in Fig. 3, low numbers of apoptotic cells were detected by the terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) method in both control (Fig. 3E) and PB-p53R172L (Fig. 3H) mice. Because p53R172L could transactivate WAF-1/p21 reporter constructs at high levels in vitro, endogenous p21 expression was examined by immunohistochemistry. As demonstrated in Fig. 3, F and I, there was no apparent difference in p21 expression between PB-p53R172L mice (57%; Fig. 3I) and control animals (53%; Fig. 3F). There was also little change in the level of cellular proliferation between nontransgenic and PB-p53R172L mice determined by BrdUrd labeling (Fig. 3, G and J, respectively). These data demonstrate that in the context of an otherwise normal prostate gland, enforced subphysiological expression of p53R172L has little consequence on epithelial cell proliferation or apoptosis in vivo.

PB-p53R172L Inhibits Prostate Cancer in Vivo
Although there was no discernable phenotype in the prostate gland as a consequence of PB-p53R172L expression, it should be noted that p53R175L had been identified in tumor tissue and shown to inhibit lobuloalveolar development in proliferating mammary tissues. Hence, we postulated that expression of p53R172L could influence the development of prostate cancer in vivo. To test the hypothesis that p53R172L exhibited tumor-specific properties, we established a cross between the PB-p53R172L mice and the TRAMP model of prostate cancer. The 18-week-old PB-p53R172L, TRAMP, TRAMP x PB-p53R172L F1 bigenic mice, and nontransgenic littermates were examined at a gross level to characterize the consequence of p53R172L expression in the context of spontaneous and autochthonous prostate cancer. Note that all mice in this study were C57BL/6 x FVB F1, and each group contained 8–14 mice. As shown in Fig. 4, we noted a marked reduction in prostate tumor burden in the TRAMP x PB-p53R172L bigenic mice. This was a very surprising result given the low level of expression of the PB-p53R172L transgene.



View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 4. Gross appearance of GU tract of nontransgenic and PB-p53R172L transgenic mice. All mice were generated by a C57BL/6 TRAMP x FVB PB-p53R172L heterozygous cross. A. Nontransgenic C57BL/6 x FVB F1 male mouse at 18 weeks of age with normal prostate and seminal vesicles. SV, seminal vesicles; P, prostate; BL, bladder. B. C57BL/6 x FVB F1 PB-p53R172L transgenic mouse at 18 weeks of age with normal prostate and seminal vesicles. C. C57BL/6 x FVB F1 TRAMP mouse at 18 weeks of age demonstrating a spherical highly vascularized prostate tumor that surrounds and engulfs the bladder but only partially engulfs the seminal vesicles. D. At 18 weeks of age, C57BL/6 x FVB F1 TRAMP/PB-p53R172L bigenic mice appeared similar to nontransgenic and PB-p53R172L mice. A TRAMP x PB-p53R172L bigenic mouse at 40 weeks of age with enlarged fluid-filled seminal vesicles secondary to an obstructive prostate tumor. E. GU weight of nontransgenic and PB-p53R172L transgenic mice. Each group contains 22 mice. Bars, SE. *, P < 0.005; **, P < 0.013, significant difference from control mice.

 
While the prostate gland and other male accessory organs were grossly similar in the nontransgenic and PB-p53R172L mice (Fig. 4, A and B), TRAMP mice typically presented with palpable and highly vascularized spherical tumors that measured from 1 to 5 cm in diameter (Fig. 4C). In stark contrast to the TRAMP mice, TRAMP x PB-p53R172L bigenic mice did not develop palpable tumors by 18 weeks of age. At more advanced ages, the bigenic mice typically presented with irregular shaped prostates, and enlarged fluid-filled seminal vesicles were common (Fig. 4D). As shown in Fig. 4E, the mean wet weight of genitourinary (GU) tracts isolated from 18-week-old TRAMP mice exceeded that recorded for all other groups by 10–15-fold (P < 0.005). There was no statistical difference in GU tract wet weight between bigenic mice and PB-p53R172L transgenic mice (P < 0.26), although there was a statistically significant difference (P < 0.013) in GU tract wet weight between bigenic mice and nontransgenic mice. More importantly, only two bigenic mice (2/11; 18%) developed small tumors (0.5 and 0.9 g) and were confined to the ventral prostate.

Histological examination confirmed that all TRAMP mice (14/14; 100%) had prostate cancer by 18 weeks of age. The tumors ranged from well-differentiated adenocarcinoma (Fig. 5, A and B) to poorly differentiated cancer according to our grading scheme (47). Of these mice, six (6/14; 43%) had palpable tumors ranging in size from 0.8 to 10.7 g. In contrast, there was no evidence of adenocarcinoma in the TRAMP x PB-p53R172L transgenic mice, although there was a profound increase in the cytoplasmic-to-nuclear ratio in the epithelial compartment and evidence of prostate intraepithelial neoplasia (Fig. 5, C and D). While metastases were common in the TRAMP mice at 18 weeks of age, metastases in the bigenic mice were not observed until the mice were older than 30 weeks of age (data not shown).



View larger version (136K):
[in this window]
[in a new window]
  		FIGURE 5. Histological analysis of prostate tissues from TRAMP and TRAMP x PB-p53R172L bigenic mice. A–D. Representative sections stained with H&E. A. Section through prostate of TRAMP male mouse demonstrating well-differentiated adenocarcinoma. B. Higher magnification of section shown in A demonstrates that individual acini contain multiple smaller glands and are surrounded by multiple layers of smooth muscle cells and stromal fibroblasts (x40). C. Section through prostate of a TRAMP x PB-p53R172L transgenic mouse shows regions with similar histology as that observed in A (x10). D. Higher magnification of section shown in C demonstrates that acini show papillary projections of epithelial cells characteristic of prostatic intraepithelial neoplasia. Individual acini surrounded by three to four layers of fibromuscular stroma, smooth muscle cells, and stromal fibroblasts (x40). E–G. Section from TRAMP mice analyzed by TUNEL method (E), immunohistochemistry with anti-p21 antibody (F), and immunohistochemistry with anti-BrdUrd antibody (G; x40). H–J. Sections from TRAMP x PB-p53R172L transgenic mice analyzed by TUNEL method (H), immunohistochemistry with anti-p21 antibody (I), and immunohistochemistry with anti-BrdUrd antibody (J; x40). Methyl green was used as counterstain. Arrows, positive cells. Black bars, 5 µm.

 
TRAMP x PB-p53R172L Mice Demonstrate Increased Apoptosis but Not Cell Proliferation
It is generally accepted that wild-type p53 can suppress tumorigenesis via two major pathways, the inhibition of cell proliferation and the induction of apoptosis. To further characterize the mechanism whereby PB-p53R172L expression suppressed prostate tumors in bigenic mice, the levels of apoptosis and cell proliferation were examined in prostate tissues obtained from TRAMP and TRAMP x PB-p53R172L bigenic mice. An increase in apoptosis was observed in bigenic mice (Fig. 5H) compared with TRAMP mice (Fig. 5E). In addition, an increase in cells expressing p21 was observed in the bigenic mice (Fig. 5I) compared with TRAMP mice (Fig. 5F). However, there was no difference in the number of proliferating cells between TRAMP mice (Fig. 5H) and bigenic mice (Fig. 5J). The proliferation and apoptotic indices (Fig. 6) were determined and a significant increase was observed in the apoptotic index (P < 0.012) but not in the proliferation index (P < 0.684) in TRAMP x PB-p53R172L bigenic mice when compared with TRAMP alone.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 6. Reduced tumor burden as a function of PB-p53R172L-directed apoptosis. The apoptotic and proliferation indices for nontransgenic controls, PB-p53R172L, TRAMP, and TRAMP x PB-p53R172L bigenic mice were estimated by counting TUNEL-positive cells and BrdUrd-labeled cells, respectively. Twenty high-power fields were counted for each of five or six paraffin sections for each of the 22 mice/cohort. Columns, mean percent positive cells; bars, SE.

 
In contrast to the data obtained by transfection analysis, expression of the proapoptotic Bax protein was consistently up-regulated in TRAMP x PB-p53R172L bigenic mice compared with all other groups (Fig. 7). This observation demonstrates the consequence of PB-p53R172L expression in vivo and raises the possibility that full activation of Bax by this p53 mutant protein may only be realized in cells actively undergoing transformation. As shown in Fig. 1, this activation is not simply attributable to the expression of the Tag oncoprotein. That such an induction of apoptosis was detected when PB-p53R172L was expressed at subphysiological levels demonstrates that p53R172L has potent tumor suppressor properties.



View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 7. Increased expression of Bax in vivo as a function of PB-p53R172L expression. Expression of Bax protein was evaluated by immunoblotting in extracts prepared from ventral prostates of 12 individual mice. Lanes 1, 5, and 9, nontransgenic mice (N); lanes 2, 6, and 10, PB-p53R172L mice (P); lanes 3, 7, and 11, TRAMP x PB-p53R172L bigenic mice (PT); and lanes 4, 8, and 12, TRAMP mice (T). Arrows, relative migration of the Bax protein. Blots were probed with antibody specific for ß-actin to demonstrate equal loading in all lanes.

 
TRAMP x PB-p53R172L Bigenic Mice Demonstrate Prolonged Survival
To study the impact of PB-p53R172L on survival in the context of TRAMP, four cohorts of mice, control, PB-p53R172L, TRAMP, and TRAMP x PB-p53R172L F1 bigenic, were established by random assignment of 22 appropriately genotyped mice to each cohort. All mice were C57BL/6 x FVB F1 littermates. The mice were followed to death or until their tumors became obviously palpable at which time they were sacrificed. Consistent with previous observations, no deaths were recorded in the control and PB-p53R172L cohorts before these mice reached 50 weeks of age. TRAMP mice began to develop palpable tumors at ~15 weeks of age and all mice were sacrificed by 30 weeks of age (Fig. 8). In contrast, none of the bigenic mice were sacrificed until ~28 weeks of age and the last of the bigenic mice was sacrificed at 48 weeks of age. This represents a 54% increase in tumor latency and a 63% increase in survival, respectively, as a consequence of p53R172L expression.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 8. Survival as a function of PB-p53R172L expression. The age at sacrifice is shown as a function of genotype. Each cohort was composed of 22 mice from a C57BL/6 TRAMP x FVB PB-p53R172L heterozygous cross. Mice were monitored daily by abdominal palpation. Animals were sacrificed when tumors were palpable (~1 g). No tumors were identified in either control (nontransgenic) or PB-p53R172L mice up to 48 weeks of age.

 

   Discussion
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
Materials and Methods
 Acknowledgements
 References
 
Loss of heterozygosity or mutation at the p53 tumor suppressor gene locus is associated with advanced human prostate cancer. The loss of wild-type p53 function has been implicated as a molecular mechanism contributing to the failure of conventional chemotherapy and radiotherapy, and replacement p53 gene therapy may therefore prove efficacious for this disease. We have explored the activity of a variant p53 molecule carrying an arginine-to-leucine mutation at codon 172, p53R172L. We demonstrate that murine p53R172L, equivalent to human p53R175L, exhibits properties characteristic of a hypermorphic positive function p53 in both cultured cells and autochthonous animal models.

In p53-null fibroblasts, the p53R172L construct was observed to induce transcription of mdm2 and WAF-1/p21 reporter constructs to levels between 2- and 5-fold over that of wild-type p53. This was not a general phenomenon related to the transfection protocol, as the variant was able to discriminate between the various p53-responsive elements. It is interesting to note that the arginine 175 residue resides within the L2 loop of p53 near the zinc-binding site (52), which is known to influence the conformation of the p53 DNA-binding domain, and p53R172L may possess a certain degree of freedom to bind to or activate WAF-1/p21 and mdm2 promoters more efficiently than wild-type p53. Furthermore, the inherent differences in the p21, mdm2, and Bax promoters likely contribute to the differential activation. It should be noted, however, that the transfection data did not predict the activation of Bax observed in the transgenic studies.

Having characterized the ability of the variant p53R172L to act as a positive sequence-specific transcription factor in cells in culture, the consequence of p53R172L expression was examined in vivo. To this end, transgenic mice were generated with a construct carrying the -426/+28-bp rat minimal probasin promoter fused to a murine p53R172L minigene. As demonstrated above, the PB-p53R172L transgene was expressed at low levels in the prostate gland of line 7856. This low-level expression was consistent with our previous observations using the minimal probasin promoter (44, 53). Although maximal expression of probasin-directed transgenes is normally achieved by 12 weeks of age (44, 53), the morphology of the normally quiescent prostatic epithelium was not altered by 18 weeks of age in the PB-p53R172L mice. The lack of an increase in cell proliferation or apoptosis in the prostate as a consequence of p53R172L expression is likely related to the level of transgene expression. In contrast, when the lactation-regulated WAP promoter was used to direct p53R172L expression in transgenic mice (41), there was a marked increase in apoptosis that altered development of the mammary gland. It should be noted that in this mammary gland model, the inhibition of normal lobuloalveolar development occurred during late pregnancy, a time of rapid cellular proliferation in the mammary gland. Consistent with the argument that high-level expression of p53R172L is cytotoxic, our attempts to isolate stable clones of prostate epithelial cells that express high levels of p53R172L following transfection have been unsuccessful (data not shown). Based on the observations with the PB-p53R172L mice and the WAP-p53R172L mice, we tend to favor the explanation that activation of the p53R172L mutant is restricted to cells undergoing rapid division and differentiation. That raised the intriguing possibility that p53R172L might exert an enhanced tumor suppressor phenotype in cells undergoing neoplastic transformation. Data supporting this interpretation come from studies showing that radiation-induced p53-mediated apoptosis can be correlated with the proliferative state of the mammary gland (54).

To test our hypothesis that p53R172L might act in a dominant manner to abrogate tumor progression in vivo, the PB-p53R172L transgenic mice were crossed to the TRAMP mice. Remarkably, this resulted in a dramatic reduction in the gross wet weight of the GU tissue and an increased apoptotic index and a corresponding decrease in tumor incidence in TRAMP x PB-p53R172L bigenic mice. Because both p21 and Bax were induced in vivo, we now propose that p53R172L has a tumor-specific function that is independent of the Tag oncoprotein. Presumably, p53R172L could also contribute to apoptosis through a p21-independent and Bax-independent mechanism, as only a slight shift in the proliferation-to-apoptosis ratio may be required to facilitate the protective phenotype. In fact, Noxa, a BH3 domain-only member of the Bcl-2 family (55), as well as the FAS receptor (56) may be mediators of p53-induced apoptosis. Clearly, additional studies will be necessary to determine if p53R172L can induce expression of these genes. Furthermore, p53 has been suggested to have apoptotic functions that are independent of transcription (57). While the expression of p53R172L in prostate could extend the survival of bigenic mice, as shown in Fig. 8, these mice were found to eventually succumb to prostate cancer. Despite the aggressive nature of the TRAMP system, the low level of PB-p53R172L expression in the bigenic mice was sufficient to increase survival by as much as 60%. In clinical terms, application of p53R175L in a therapeutic strategy might translate into significant reductions in mortality and associated morbidity.

In conclusion, we undertook in vitro and in vivo studies to address the activity of a variant p53 molecule, p53R172L. Our in vitro studies indicated p53R172L possesses promoter-specific properties. While in vivo, expression of low-level expression p53R172L in otherwise normal prostate epithelial cells resulted in no observable abnormalities. When expressed in combination with the autochthonous TRAMP model, the subphysiological expression of p53R172L significantly decreased tumor incidence and tumor growth. The observation that low-level expression of p53R172L could specifically induce significant apoptosis in tumor cells in vivo suggests that p53R172L may be a good candidate for gene therapy.


   Materials and Methods
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
Acknowledgements
 References
 
Plasmids
For transfection studies, the p53 expression plasmids consist of either murine wild-type p53 or mutant p53R172L minigene (41) fused between the cytomegalovirus promoter and SV40 cleavage and the polyadenylic acid signals in pBluescript SK- (Stratagene, La Jolla, CA). The Bax-luc, p21-luc, and mdm2-luc constructs (a generous gift of Dr. M. Oren) contain the p53 response elements as described previously (20, 58, 59).

Cell Culture
The p53-null fibroblasts were established from a p53-/- mouse embryo (a generous gift of Dr. G. Lozano) and grown in DMEM (Life Technologies, Inc., Rockville, MD) supplemented with 10% fetal bovine serum (Hyclone Laboratories, Logan, UT) and 25 units/ml of penicillin and streptomycin (Life Technologies).

Half-life Measurement
Cells were seeded into 100-mm plates and grown to 60% confluence. Transfections were performed with SuperFect method (Qiagen, Inc., Valencia, CA) with 5 µg of either wild-type p53 or p53R172L expression plasmids for 24 h. Protein half-life was determined by radioactive pulse labeling with 200 µCi/ml of Trans-[35S] Label (1175 Ci/mmol; ICN Radiochemicals, Irvine, CA) in methionine- and cysteine-free DMEM (ICN) containing 2% dialyzed fetal bovine serum (Hyclone) for 15 min and chased in DMEM containing 10% fetal bovine serum and 2 mM unlabeled methionine and cysteine for 0, 1, 2, and 3 h. The cells were harvested in lysis buffer [50 mM Tris (pH 8.0), 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin, and 1 mM polymethylsulfonyl fluoride], and the p53 proteins were immunoprecipitated with the polyclonal antibody FL-393 (Santa Cruz Biotechnology, Santa Cruz, CA). Precipitates were resolved by electrophoresis through 10% SDS-polyacrylamide gels. Quantification of labeled protein was performed with a STORM PhosphorImager (Amersham Biosciences, Piscataway, NJ).

Transactivation Assays
For transactivation assays, 7.5 x 105 cells were plated in six-well plates for 24 h. Transfections were carried out with 0.5 µg of wild-type p53 or p53R172L expression plasmids and 0.1 µg of reporter plasmid using the SuperFect method as described above. Cells were washed in DMEM and harvested 28 h later in lysis buffer [0.2 mM Tris (pH 8.0), 0.1% Triton X-100]. Luciferase activity was determined by mixing a 20 µl aliquot of the cell lysate with 100 µl of luciferase assay reagent [20 mM Tris (pH 8.0), 4 mM MgSO4, 0.1 mM EDTA, 30 mM dithiothreitol, 0.5 mM luciferin, and 0.25 mM acetyl-CoA] and each reaction was monitored for 10 s in a luminomitor.

Western Blotting
Aliquots of cell lysates prepared for transactivation assays were subjected to SDS-PAGE and transferred to polyvinylidene fluoride membrane (Millipore, Billerica, MA). Membranes were washed in TBST [10 mM Tris (pH 7.4), 150 mM NaCl, 0.05% Tween 20] and blocked by incubation with 5% Carnation milk in TBST at room temperature for 1 h. Blots were incubated overnight at 4°C with antibodies in TBST containing 3% Carnation nonfat dry milk. The antibodies were used at a dilution of 1:750 for the anti-p53 antibody (FL-393; Santa Cruz Biotechnology) and 1:5000 for the anti-ß-actin antibody (AC-74; Sigma Chemical Co., St. Louis, MO). The immunocomplexes were detected using a horseradish peroxidase-linked anti-rabbit or horseradish peroxidase-linked anti-mouse antibodies as appropriate, each at a dilution of 1:5000 in 3% Carnation milk in TBST for 1 h at room temperature. The secondary antibodies were visualized using the enhanced chemiluminescence substrate development (Pierce Chemical Co., Rockford, IL). Immunoreactive bands were quantified using AlphaImager 2000 (3.3) from Alpha Innotech Corporation (San Leandro, CA).

Transgenic Mice
To target expression of p53R172L to mouse prostate epithelium, the hybrid minigene (41) was placed downstream of the minimal -426/+28 rat probasin promoter modified to carry flanking SalI restriction sites. The restriction sites were introduced by 20 cycles of PCR using primers:

PB1: CCGGTCGACCGGAAGCTTCCACAAGTGCATTTA and
PB2: CCGGTCGACCGGCTGTAGGTATCTGGACCTCAC.

The integrity of the PCR fragment was confirmed by DNA sequencing and subcloned into the unique SalI site upstream of the murine p53R172L minigene in plasmid pBL103 (41). A 5-kb BssHII DNA fragment carrying the transgene free of vector sequence was purified by adsorption to Qiaex beads and was introduced into FVB embryos by microinjection. Founders carrying the PB-p53R172L transgene were identified by PCR screening (60) and primers:

P1: CCGGTCGACCGGAAGCTTCCACAAGTGCATTTA and
P2: GCCTGAAAATGTCTCCTGGCTCAGAGGG (Fig. 3A).

TRAMP mice were maintained in a pure C57BL/6 background and screened as described previously (44). The bigenic C57BL/6 x FVB F1 mice were generated by a cross of PB-p53R172L and TRAMP mice and were identified by multiplex PCR by the method described above. All mice in this study carrying PB-SV40 early genes (TRAMP) or the PB-p53R172L constructs were obtained as C57BL/6 x FVB F1 littermates. Nontransgenic C57BL/6 x FVB F1 littermates were used as controls in all studies.

RNA Extraction and Analysis
Prostate RNA samples were prepared as described (46). Total RNA was isolated from all other mouse tissues as described previously (61). For RT-PCR analysis, 1 µg of total RNA was reverse transcribed as described previously (44), except the RT reaction temperature was 42°C and the annealing temperature during PCR was 68°C. Expression of the p53 transgene was detected with primers:

P3: CTTGTCAGTGAGGTCCAGATACCTACAG and
P5: GTGGGGGCAGAGTCTCACGACCCCC.

Expression of endogenous p53 was detected with primer P4: ATGACTGCCATGGAGGAGTCACAGT and primer P5. RT-PCR products were fractionated on 1.2% agarose gels transferred to Zetaprobe membranes and probed with an [{alpha}]32P-dCTP-labeled 500-bp AvaI fragment of mouse p53 cDNA.

Measurement of Prostate Wet Weight
The GU tracts of transgenic and control mice were removed at necropsy according to the method described by Gingrich et al. (46). Following resection of seminal vesicles and coagulating gland, remaining bladder, urethra, and prostatic tissues were removed by microdissection, and weights were determined on a digital microbalance (Fisher Scientific, Pittsburgh, PA). Statistical analysis was performed using the Student's t test and Mann-Whitney methods (StatView 4.5, Abacus Concepts, Inc., Berkeley, CA) on a Macintosh Power PC computer (Apple Computer, Copertino, CA). Results were plotted using DeltaGraph Professional.

Histology and Immunocytochemistry
Prostate glands and other organs were surgically removed at necropsy, fixed in 10% neutral buffered formalin for 6 h, placed in 70% ethanol overnight, and processed and embedded in paraffin as described previously (44). Sections cut at 4 µm were placed on Probe-on Plus slides (Fisher Scientific) and every 10th slide was stained with H&E. The TUNEL method used to visualize apoptotic cells and the BrdUrd incorporation employed to visualize proliferating cells were performed as described previously (32, 62). Briefly, to detect p21, sections were deparaffinized and incubated with 20 µg/ml proteinase K for 5 min at room temperature. Endogenous peroxidases were quenched using 2% H2O2, and nonspecific binding sites were blocked with 5% goat serum for 30 min. Sections were incubated with a rabbit polyclonal antibody against p21 (generously provided by Dr. Wade Harper, Baylor College of Medicine) at a 1:400 dilution overnight at 4°C. The sections were washed, incubated with secondary antibody, and visualized using avidin-biotin complex immunoperoxidase technique (Vectastain ABC kit, Vector Laboratories, Burlingame, CA).


   Acknowledgements
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
References
 
We thank the faculty and staff at Baylor College of Medicine Center for Comparative Medicine for their advice and assistance. We also thank Dr. L. Donehower for critical reading of the manuscript.


   Notes
Top
 Notes
Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 
1 National Cancer Institute awards CA58206, CA64851, and CA884296 and a CaP CURE award to N. M. G.

Note: Immaculada Hernandez, Lisette A. Madison and Yongli Wei contributed equally to this work. Back

Received August 12, 2003; revised October 29, 2003; accepted October 30, 2003.


   References
Top
 Notes
 Abstract
 Introduction
 Results
 Discussion
 Materials and Methods
 Acknowledgements
 References
 

  1. Jemal, A., Murray, T., Samuels, A., Ghafoor, A., Ward, E., and Thun, M. J. Cancer statistics, 2003. CA Cancer J. Clin., 53: 5–26, 2003.[Abstract/Free Full Text]
  2. Bookstein, R., MacGrogan, D., Hilsenbeck, S. G., Sharkey, F., and Allred, D. C. p53 is mutated in a subset of advanced-stage prostate cancers. Cancer Res., 53: 3369–3373, 1993.[Abstract/Free Full Text]
  3. Eastham, J. A., Stapleton, A. M., Gousse, A. E., Timme, T. L., Yang, G., Slawin, K. M., Wheeler, T. M., Scardino, P. T., and Thompson, T. C. Association of p53 mutations with metastatic prostate cancer. Clin. Cancer Res., 1: 1111–1118, 1995.[Abstract]
  4. Osman, I., Drobnjak, M., Fazzari, M., Ferrara, J., Scher, H. I., and Cordon-Cardo, C. Inactivation of the p53 pathway in prostate cancer: impact on tumor progression. Clin. Cancer Res., 5: 2082–2088, 1999.[Abstract/Free Full Text]
  5. Downing, S. R., Jackson, P., and Russell, P. J. Mutations within the tumor suppressor gene p53 are not confined to a late event in prostate cancer progression. a review of the evidence. Urol. Oncol., 6: 103–110, 2001.[Medline]
  6. Stapleton, A. M., Timme, T. L., Gousse, A. E., Li, Q. F., Tobon, A. A., Kattan, M. W., Slawin, K. M., Wheeler, T. M., Scardino, P. T., and Thompson, T. C. Primary human prostate cancer cells harboring p53 mutations are clonally expanded in metastases. Clin. Cancer Res., 3: 1389–1397, 1997.[Abstract]
  7. Meyers, F. J., Gumerlock, P. H., Chi, S. G., Borchers, H., Deitch, A. D., and deVere White, R. W. Very frequent p53 mutations in metastatic prostate carcinoma and in matched primary tumors. Cancer, 83: 2534–2539, 1998.[Medline]
  8. Navone, N. M., Labate, M. E., Troncoso, P., Pisters, L. L., Conti, C. J., von Eschenbach, A. C., and Logothetis, C. J. p53 mutations in prostate cancer bone metastases suggest that selected p53 mutants in the primary site define foci with metastatic potential. J. Urol., 161: 304–308, 1999.[Medline]
  9. Navone, N. M., Troncoso, P., Pisters, L. L., Goodrow, T. L., Palmer, J. L., Nichols, W. W., von Eschenbach, A. C., and Conti, C. J. p53 protein accumulation and gene mutation in the progression of human prostate carcinoma. J. Natl. Cancer Inst., 85: 1657–1669, 1993.[Abstract/Free Full Text]
  10. Koivisto, P. A. and Rantala, I. Amplification of the androgen receptor gene is associated with P53 mutation in hormone-refractory recurrent prostate cancer. J. Pathol., 187: 237–241, 1999.[Medline]
  11. Burchardt, M., Burchardt, T., Shabsigh, A., Ghafar, M., Chen, M. W., Anastasiadis, A., de la Taille, A., Kiss, A., and Buttyan, R. Reduction of wild type p53 function confers a hormone resistant phenotype on LNCaP prostate cancer cells. Prostate, 48: 225–230, 2001.[Medline]
  12. Cheng, L., Leibovich, B. C., Bergstralh, E. J., Scherer, B. G., Pacelli, A., Ramnani, D. M., Zincke, H., and Bostwick, D. G. p53 alteration in regional lymph node metastases from prostate carcinoma: a marker for progression? Cancer, 85: 2455–2459, 1999.[Medline]
  13. Zhu, J., Gao, B., Zhao, J., and Balmain, A. Targeting gene expression to tumor cells with loss of wild-type p53 function. Cancer Gene Ther., 7: 4–12, 2000.[Medline]
  14. Kastan, M. B., Onyekwere, O., Sidransky, D., Vogelstein, B., and Craig, R. W. Participation of p53 protein in the cellular response to DNA damage. Cancer Res., 51: 6304–6311, 1991.[Medline]
  15. Lanni, J. S. and Jacks, T. Characterization of the p53-dependent postmitotic checkpoint following spindle disruption. Mol. Cell. Biol., 18: 1055–1064, 1998.[Abstract/Free Full Text]
  16. Zindy, F., Eischen, C. M., Randle, D. H., Kamijo, T., Cleveland, J. L., Sherr, C. J., and Roussel, M. F. Myc signaling via the ARF tumor suppressor regulates p53-dependent apoptosis and immortalization. Genes Dev., 12: 2424–2433, 1998.[Abstract/Free Full Text]
  17. Lane, D. P. Cancer. p53, guardian of the genome. Nature, 358: 15–16, 1992.[Medline]
  18. el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817–825, 1993.[Medline]
  19. Hermeking, H., Lengauer, C., Polyak, K., He, T. C., Zhang, L., Thiagalingam, S., Kinzler, K. W., and Vogelstein, B. 14-3-3 {sigma} is a p53-regulated inhibitor of G2-M progression. Mol. Cell, 1: 3–11, 1997.[Medline]
  20. Miyashita, T. and Reed, J. C. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell, 80: 293–299, 1995.[Medline]
  21. Gurova, K. V., Roklin, O. W., Krivokrysenko, V. I., Chumakov, P. M., Cohen, M. B., Feinstein, E., and Gudkov, A. V. Expression of prostate specific antigen (PSA) is negatively regulated by p53. Oncogene, 21: 153–157, 2002.[Medline]
  22. Haupt, Y., Maya, R., Kazaz, A., and Oren, M. Mdm2 promotes the rapid degradation of p53. Nature, 387: 296–299, 1997.[Medline]
  23. Kubbutat, M. H., Jones, S. N., and Vousden, K. H. Regulation of p53 stability by Mdm2. Nature, 387: 299–303, 1997.[Medline]
  24. Momand, J., Zambetti, G. P., Olson, D. C., George, D., and Levine, A. J. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell, 69: 1237–1245, 1992.[Medline]
  25. Hussain, S. P. and Harris, C. C. Molecular epidemiology of human cancer: contribution of mutation spectra studies of tumor suppressor genes. Cancer Res., 58: 4023–4037, 1998.[Free Full Text]
  26. Walker, D. R., Bond, J. P., Tarone, R. E., Harris, C. C., Makalowski, W., Boguski, M. S., and Greenblatt, M. S. Evolutionary conservation and somatic mutation hotspot maps of p53: correlation with p53 protein structural and functional features. Oncogene, 18: 211–218, 1999.[Medline]
  27. Levine, A. J., Momand, J., and Finlay, C. A. The p53 tumor suppressor gene. Nature, 351: 453–456, 1991.[Medline]
  28. Dittmer, D., Pati, S., Zambetti, G., Chu, S., Teresky, A. K., Moore, M., Finlay, C., and Levine, A. J. Gain of function mutations in p53. Nat. Genet., 4: 42–46, 1993.[Medline]
  29. van Oijen, M. G. and Slootweg, P. J. Gain-of-function mutations in the tumor suppressor gene p53. Clin. Cancer Res., 6: 2138–2145, 2000.[Abstract/Free Full Text]
  30. Shi, X. B., Nesslinger, N. J., Deitch, A. D., Gumerlock, P. H., and deVere White, R. W. Complex functions of mutant p53 alleles from human prostate cancer. Prostate, 51: 59–72, 2002.[Medline]
  31. Hadsell, D. L., Murphy, K. L., Bonnette, S. G., Reece, N., Laucirica, R., and Rosen, J. M. Cooperative interaction between mutant p53 and des(1-3)IGF-I accelerates mammary tumorigenesis. Oncogene, 19: 889–898, 2000.[Medline]
  32. Li, B., Rosen, J. M., McMenamin-Balano, J., Muller, W. J., and Perkins, A. S. neu/ERBB2 cooperates with p53-172H during mammary tumorigenesis in transgenic mice. Mol. Cell. Biol., 17: 3155–3163, 1997.[Abstract]
  33. Murphy, K. L., Dennis, A. P., and Rosen, J. M. A gain of function p53 mutant promotes both genomic instability and cell survival in a novel p53-null mammary epithelial cell model. FASEB J., 14: 2291–2302, 2000.[Abstract/Free Full Text]
  34. Murphy, K. L. and Rosen, J. M. Mutant p53 and genomic instability in a transgenic mouse model of breast cancer (in process citation). Oncogene, 19: 1045–1051, 2000.[Medline]
  35. Coles, C., Condie, A., Chetty, U., Steel, C. M., Evans, H. J., and Prosser, J. p53 mutations in breast cancer. Cancer Res., 52: 5291–5298, 1992.[Abstract/Free Full Text]
  36. Marchetti, A., Pellegrini, S., Sozzi, G., Bertacca, G., Gaeta, P., Buttitta, F., Carnicelli, V., Griseri, P., Chella, A., Angeletti, C. A., Pierotti, M., and Bevilacqua, G. Genetic analysis of lung tumors of non-smoking subjects: p53 gene mutations are constantly associated with loss of heterozygosity at the FHIT locus. Br. J. Cancer, 78: 73–78, 1998.[Medline]
  37. Suzuki, H., Takahashi, T., Kuroishi, T., Suyama, M., Ariyoshi, Y., and Ueda, R. p53 mutations in non-small cell lung cancer in Japan: association between mutations and smoking. Cancer Res., 52: 734–736, 1992.[Abstract/Free Full Text]
  38. DeMarini, D. M., Landi, S., Tian, D., Hanley, N. M., Li, X., Hu, F., Roop, B. C., Mass, M. J., Keohavong, P., Gao, W., Olivier, M., Hainaut, P., and Mumford, J. L. Lung tumor KRAS and TP53 mutations in nonsmokers reflect exposure to PAH-rich coal combustion emissions. Cancer Res., 61: 6679–6681, 2001.[Abstract/Free Full Text]
  39. Cripps, K. J., Purdie, C. A., Carder, P. J., White, S., Komine, K., Bird, C. C., and Wyllie, A. H. A study of stabilization of p53 protein versus point mutation in colorectal carcinoma. Oncogene, 9: 2739–2743, 1994.[Medline]
  40. Hasegawa, H., Ueda, M., Furukawa, K., Watanabe, M., Teramoto, T., Mukai, M., and Kitajima, M. p53 gene mutations in early colorectal carcinoma. De novo vs. adenoma-carcinoma sequence. Int. J. Cancer, 64: 47–51, 1995.[Medline]
  41. Li, B., Greenberg, N., Stephens, L., Meyn, R., Medina, D., and Rosen, J. Preferential overexpression of a 172Arg -> Leu mutant p53 in the mammary gland of transgenic mice results in altered lobuloalveolar development. Cell Growth & Differ., 5: 711–721, 1994.[Abstract]
  42. Li, B., Kittrell, F. S., Medina, D., and Rosen, J. M. Delay of dimethylbenz[a]anthracene-induced mammary tumorigenesis in transgenic mice by apoptosis induced by an unusual mutant p53 protein. Mol. Carcinog., 14: 75–83, 1995.[Medline]
  43. Ory, K., Legros, Y., Auguin, C., and Soussi, T. Analysis of the most representative tumor-derived p53 mutants reveals that changes in protein conformation are not correlated with loss of transactivation or inhibition of cell proliferation. EMBO J., 13: 3496–3504, 1994.[Medline]
  44. Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen, J. M. Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. USA, 92: 3439–3443, 1995.[Abstract/Free Full Text]
  45. Gingrich, J. R. and Greenberg, N. M. A transgenic mouse prostate cancer model. Toxicol. Pathol., 24: 502–504, 1996.[Medline]
  46. Gingrich, J. R., Barrios, R. J., Morton, R. A., Boyce, B. F., DeMayo, F. J., Finegold, M. J., Angelopoulou, R., Rosen, J. M., and Greenberg, N. M. Metastatic prostate cancer in a transgenic mouse. Cancer Res., 56: 4096–4102, 1996.[Abstract/Free Full Text]
  47. Kaplan-Lefko, P. J., Chen, T. M., Ittmann, M., Barrios, R. S., Ayala, G. E., Huss, W. J., Maddison, L. A., Foster, B. A., and Greenberg, N. M. Pathobiology of autochthonous prostate cancer in a pre-clinical transgenic mouse model. Prostate, 55: 219–237.
  48. Raycroft, L., Wu, H. Y., and Lozano, G. Transcriptional activation by wild-type but not transforming mutants of the p53 anti-oncogene. Science, 249: 1049–1051, 1990.[Abstract/Free Full Text]
  49. Raycroft, L., Schmidt, J. R., Yoas, K., Hao, M. M., and Lozano, G. Analysis of p53 mutants for transcriptional activity. Mol. Cell. Biol., 11: 6067–6074, 1991.[Abstract/Free Full Text]
  50. Jiang, D., Srinivasan, A., Lozano, G., and Robbins, P. D. SV40 T antigen abrogates p53-mediated transcriptional activity. Oncogene, 8: 2805–2812, 1993.[Medline]
  51. Tyner, S. D., Venkatachalam, S., Choi, J., Jones, S., Ghebranious, N., Igelmann, H., Lu, X., Soron, G., Cooper, B., Brayton, C., Hee Park, S., Thompson, T., Karsenty, G., Bradley, A., and Donehower, L. A. p53 mutant mice that display early aging-associated phenotypes. Nature, 415: 45–53, 2002.[Medline]
  52. Cho, Y., Gorina, S., Jeffrey, P. D., and Pavletich, N. P. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations (see comments). Science, 265: 346–355, 1994.[Abstract/Free Full Text]
  53. Greenberg, N. M., DeMayo, F. J., Sheppard, P. C., Barrios, R., Lebovitz, R., Finegold, M., Angelopoulou, R., Dodd, J. G., Duckworth, M. L., and Rosen, J. M. The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol. Endocrinol., 8: 230–239, 1994.[Abstract]
  54. Minter, L. M., Dickinson, E. S., Naber, S. P., and Jerry, D. J. Epithelial cell cycling predicts p53 responsiveness to {gamma}-irradiation during post-natal mammary gland development. Development, 129: 2997–3008, 2002.
  55. Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi, T., and Tanaka, N. Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science, 288: 1053–1058, 2000.[Abstract/Free Full Text]
  56. Hara, I., Miyake, H., Hara, S., Arakawa, S., and Kamidono, S. Differential involvement of the Fas receptor/ligand system in p53-dependent apoptosis in human prostate cancer cells. Prostate, 45: 341–349, 2000.[Medline]
  57. Kokontis, J. M., Wagner, A. J., O'Leary, M., Liao, S., and Hay, N. A transcriptional activation function of p53 is dispensable for and inhibitory of its apoptotic function. Oncogene, 20: 659–668, 2001.[Medline]
  58. Datto, M. B., Yu, Y., and Wang, X. F. Functional analysis of the transforming growth factor ß responsive elements in the WAF1/Cip1/p21 promoter. J. Biol. Chem., 270: 28623–28628, 1995.[Abstract/Free Full Text]
  59. Wu, X., Bayle, J. H., Olson, D., and Levine, A. J. The p53-mdm-2 autoregulatory feedback loop. Genes Dev., 7: 1126–1132, 1993.[Abstract/Free Full Text]
  60. Hanley, T. and Merlie, J. P. Transgene detection in unpurified mouse tail DNA by polymerase chain reaction. Biotechniques, 10: 56, 1991.[Medline]
  61. Wei, Y., Yarus, S., Greenberg, N. M., Whitsett, J., and Rosen, J. M. Production of human surfactant protein C in milk of transgenic mice. Transgenic Res., 4: 232–240, 1995.[Medline]
  62. Humphreys, R. C., Krajewska, M., Krnacik, S., Jaeger, R., Weiher, H., Krajewski, S., Reed, J. C., and Rosen, J. M. Apoptosis in the terminal endbud of the murine mammary gland: a mechanism of ductal morphogenesis. Development, 122: 4013–4022, 1996.[Abstract]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
B. A. Narayanan, N. K. Narayanan, B. Pittman, and B. S. Reddy
Regression of Mouse Prostatic Intraepithelial Neoplasia by Nonsteroidal Anti-inflammatory Drugs in the Transgenic Adenocarcinoma Mouse Prostate Model
Clin. Cancer Res., November 15, 2004; 10(22): 7727 - 7737.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
O. Ashur-Fabian, A. Avivi, L. Trakhtenbrot, K. Adamsky, M. Cohen, G. Kajakaro, A. Joel, N. Amariglio, E. Nevo, and G. Rechavi
Evolution of p53 in hypoxia-stressed Spalax mimics human tumor mutation
PNAS, August 17, 2004; 101(33): 12236 - 12241.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow