This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cooper, S. J. Articles by Bowden, G. T. Search for Related Content PubMed PubMed Citation Articles by Cooper, S. J. Articles by Bowden, G. T.

---

Signaling and Regulation

Expression of Dominant Negative c-jun Inhibits Ultraviolet B-Induced Squamous Cell Carcinoma Number and Size in an SKH-1 Hairless Mouse Model¹

¹ Department of Radiation Oncology, Arizona Cancer Center and ² Department of Epidemiology and Biostatistics, College of Public Health, The University of Arizona, Tucson, AZ; and
³ Basic Research Laboratory, National Cancer Institute, Frederick, MD

Requests for reprints: G. Tim Bowden, Arizona Cancer Center, Room 4999, 1515 North Campbell Avenue, Tucson, AZ 85724. Phone: (520) 626-6006; Fax: (520) 626-4979. E-mail: tbowden{at}azcc.arizona.edu

	Abstract

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 
UVB radiation is a complete carcinogen able to initiate, promote, and progress keratinocyte cells toward carcinogenesis. Exposure to UVB leads to the propagation of a number of signal transduction pathways resulting in increased DNA binding of transcription factors, including activator protein-1 (AP-1), and subsequent gene expression. To test the hypothesis that AP-1 activation plays a role in the promotion of UVB-induced skin tumors, a dominant negative c-jun (TAM67) mutant transgene was expressed in the epidermis of SKH-1 hairless mice and bred with mice expressing an AP-1 luciferase reporter gene. Single UVB exposure experiments showed a significant decrease in AP-1 activity, as measured by luciferase levels, in mice expressing TAM67 72 h postexposure. Transgenic and nontransgenic littermates were placed into a chronic UVB exposure experiment, three exposures per week for 25 weeks. Expression of TAM67 reduced the number of tumors per mouse by 58% and tumor sizes were 79% smaller than the tumors present in the nontransgenic study group. These tumors were histologically identified as squamous cell carcinomas. TAM67 had no effect on UVB-induced hyperplasia because comparable epidermal thickening was observed in both study groups over a 5-day period post-UVB exposure. Immunohistochemical analysis showed a reduction in the number of cyclin D₁-expressing cells in squamous cell carcinoma samples removed from the TAM67 study group. These data show that TAM67 can inhibit UVB-induced squamous cell carcinoma formation, suggesting that AP-1 is a good candidate target for the development of new chemoprevention strategies to prevent sunlight-induced skin cancers.

Key Words: UVB • activator protein-1 • TAM67 • skin carcinogenesis • SKH-1 hairless mice

	Introduction

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 
Epidemiological studies have indicated that the application of sunscreens and sun blocks are not totally effective in preventing solar radiation-induced skin carcinogenesis; therefore, new-targeted approaches are needed for chemoprevention of skin cancer. Prevention as a means to lower incidence is a major research priority especially because each year new cases of skin cancer account for 50% of all new cancers reported. Although three regions of UV light (UVA, UVB, and UVC) are contained in solar radiation, only UVA and UVB reach the earth's surface with UVC being filtered out by the ozone layer (1). Both UVB and to a lesser extent UVA are responsible for sunlight-induced cancers of the skin (2, 3). UVB has been demonstrated to be a complete carcinogen able to induce initiation, promotion, and progression of exposed epidermal cells although molecular mechanisms are still unclear as to how normal exposed cells are progressed toward a malignant tumor.

Exposure of mammalian cells to UVB radiation results in the activation of a number of transcription factor protein families including activator protein-1 (AP-1) and nuclear factor B (NF-B; 4, 5) leading to the activation of a number of genes, termed UV response genes. The AP-1 family of proteins has been shown to be involved in cell proliferation and survival and, therefore, plays an important role in tumor progression (6). There is continuing evidence that the AP-1 family of proteins is able to bring about these cell proliferation and survival effects by regulating the expression and function of a number of cell cycle regulators including Cyclin D1, p53, p21 (cip1/waf1), p19 (ARF), and p16 (6). Knockout strategies have also demonstrated that AP-1 protein family members such as c-Jun, JunB, and Fra-1 are essential for mouse embryonic development (7) and that the absence of c-Jun leads to elevated levels of both p53 and its target gene, p21, in fibroblasts (8).

Experiments in JB6 cells first provided evidence for the role of AP-1 in skin tumor promotion and progression (9).These experiments showed that cells sensitive to tumor promotion had an elevated AP-1 activity in response to tumor-promoting agents when compared to promotion-resistant cells. Later work identified constitutively active AP-1 in malignant versus benign tumor cells as measured by sequence-specific DNA binding and transactivation studies (10), suggesting that constitutive activation of AP-1 may lead to a sustained deregulation of gene expression within these malignant cells. A role for AP-1 in the transformation of mammalian cells has further been brought to light by the use of dominant negative protein studies. The expression of a deletion mutant of the c-jun gene (TAM67) that is missing a portion of its transactivation domain is able to inhibit the transformation of normal rat embryo cells (11). The expression of this deletion mutant of the c-jun gene also inhibited transformation of rat embryo cells after exposure to the tumor promoter 12-O-teradecanoylphorbol-13-acetate (TPA; Ref. 11).

Recent investigations have started to dissect the in vivo contributions of AP-1 activation to tumorigenesis. Studies utilizing malignant mouse epidermal cells stably transfected with TAM67 showed an inhibition in both the AP-1 transactivation response and in the cells' ability to form s.c. tumors when injected into athymic nude mice (12). Young et al. (13) expressed the TAM67 mutant in the epidermis of transgenic mice, and after DMBA/TPA exposure, demonstrated for the first time that AP-1 transactivation was a required step for in vivo TPA-induced tumor promotion. Recent studies from this laboratory have identified that expression of the TAM67 mutant in the epidermis of ICR mice blocks okadaic acid (OA)-induced skin tumor promotion (14). In the present study, we demonstrate that the expression of TAM67 on an SKH-1 hairless mouse background decreases both skin tumor number and size after chronic exposure to UVB radiation. The inhibition of UVB-induced skin carcinogenesis was associated with an inhibition in the skin of UVB-induced AP-1 activation.

	Results

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 
Expression of the K14-TAM67 transgene in the skin of the transgenic mice was determined by RNA analysis using a two-tube reverse transcription (RT)-PCR technique (Fig. 1). The primers used were specific for TAM67 and an exon of the human growth hormone gene located downstream of the TAM67 sequence. As a control for DNA contamination, reactions for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were included in these experiments. It was determined that TAM67 was actively transcribed in the epidermis of transgenic mice but not in their nontransgenic littermates.

View larger version (52K): [in this window] [in a new window]   FIGURE 1. Transcription of TAM67 in TAM+ mice but not in TAM- littermates. Epidermal layers were separated from dorsal skin samples and snap frozen in liquid nitrogen. Total RNA was extracted by the use of guanidinium salt and phenol/chloroform extraction before undergoing DNA removal. RT-PCR was used for the determination of TAM67 transcription from this RNA. GAPDH was included in these experiments as a positive control for reverse transcription.

View larger version (10K): [in this window] [in a new window]   FIGURE 2. Inhibition of UVB-induced AP-1-driven Luc activity in TAM67+ mice. Mice were anesthetized and 3 x 1.5 mm ear punches were removed from their right ears before receiving a 10-kJ/m2 dose of UVB. Seventy-two hours post-UVB, 3 x 1.5 mm punches were taken from the left ear, snap frozen, and lysed. A BCA protein assay was performed on all ear punches and the Luc activity of the samples determined using 20 µg of protein. Significant differences between UVB-exposed AP-1 Luc mice and TAM67+/Luc mice are marked as * P = 0.045.

View larger version (26K): [in this window] [in a new window]   FIGURE 3. TAM67 expression reduces UVB-induced skin tumor size and number. TAM67+ and TAM67- mice were exposed to a 25-week course of UVB starting at a dose of 2.5 kJ/m2 with a dosage increase of 1.5 kJ/m2 every week until the maximum dosage of 9 kJ/m2 was achieved at the 6th week. Tumor appearance, size, and number per mouse were measured weekly throughout the experiment and recorded. Significant differences between TAM67+ and TAM67- groups were apparent in tumor number (A) at week 25, P = 0.007, and when comparing the slopes of the curves, P < 0.001, and in tumor volume (B) at week 25, P = 0.006 and differences between the slopes, P = 0.012.

View larger version (15K): [in this window] [in a new window]   FIGURE 4. Expression of TAM67 has no effect on UVB-induced hyperplasia. Dorsal skin samples from TAM67+ and TAM67- mice were isolated 0–120 h after exposure to 10 kJ/m2 UVB. Samples were fixed in buffered formalin, embedded in paraffin, and stained with H&E. Distances from the top of the basement membrane to the bottom of the stratum corneum were measured, three measurements per field, 10 fields per sample.

View larger version (11K): [in this window] [in a new window]   FIGURE 5. TAM67 reduces UVB-induced expression of cyclin D1 in squamous cell carcinomas. Skin tumors isolated from TAM67+ (n = 3) and TAM67- (n = 4) mice were formalin fixed, paraffin embedded, and then analyzed using immunohistochemistry for the expression of cyclin D1. Ten random fields per slide were counted with cells containing a brown precipitate recorded as positive. Positively stained cells per tumor were averaged across all replicate fields to obtain a single reliable value. Statistically significant differences between UVB-exposed TAM67- (control) mice and TAM67+ are marked as * P = 0.029.

	Discussion

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

The ability of TAM67 to inhibit AP-1 transactivation is due to its ability to sequester Jun and Fos family members into low-activity transcription factor complexes (11). The transactivation of AP-1-dependent genes has been reported to be necessary for tumor promotion by TPA (13) and OA (14) in vivo, and for tumor promoter-induced transformation in mouse epidermal JB6 cells (19). In addition, expression of TAM67 in mouse keratinocytes is able to block TPA-induced invasion (20), and in malignant epidermal cell lines inhibits the formation of tumors when these cells are injected into athymic nude mice (12).

Early responses in the skin of SKH-1 mice after an acute UVB exposure include increased number of cells expressing both p21 and p53 and thickening of the epidermis (15). Interestingly, the expression of TAM67 had no effect on UVB-induced epithelial hyperplasia agreeing with similar findings observed in chemically induced carcinogenesis models using both OA and TPA (13, 14), as well as in Human Papillomavirus Type-16 (HPV) E7-induced hyperplasia (21). Chronic UVB exposure of SKH-1 mice results in modulation of the expression of cell cycle markers, with p53 and cyclin D₁ overexpression correlating with the development of skin tumors (17). Therefore, this expression of cyclin D₁ in squamous cell carcinomas contributes to the tumor phenotype even in the presence of elevated p53 levels. Elevated cyclin D₁ expression is seen in squamous carcinoma and papillomas but not in normal or hyperproliferative skin (22) while decreased expression leads to reduced skin carcinogenesis (16). Squamous cell carcinomas removed from chronically exposed UVB SKH-1 mice in our investigation showed increases in cyclin D₁ protein levels when compared to normal dorsal skin sections at the end of the 25-week experiment. Expression of TAM67 significantly reduced cyclin D₁ protein expression in UVB-induced squamous cell carcinoma samples but did not modulate basal levels of cyclin D₁ in the untreated transgenic mouse skin.

Kim et al. (17) reported that the magnitude of cyclin D₁ overexpression correlates well with skin tumor progression, and the onset of cyclin D₁ accumulation coincides with the sudden increase in the number of tumors per animal. Considering the persistent expression of cyclin D₁ during UVB-induced murine skin carcinogenesis, Kim et al. suggested that cyclin D₁ might contribute to the neoplastic process by providing a growth advantage during the early stages of tumor promotion. Finally, these authors concluded that the high levels of cyclin D₁ in individual tumors suggest an important role during malignant progression. Because UVB-mediated responses observed in murine skin parallel those reported in human skin cancer development, it is likely that alterations in cyclin D₁ expression are important in human skin carcinogenesis caused by chronic sun exposure.

Experiments in fibroblasts have identified that c-Jun mediates G₁ cell cycle progression by a mechanism that involves direct transcriptional control of the cyclin D₁ gene (23). Our observations suggest a direct mechanism for AP-1 in regulating cyclin D₁ expression because lower levels of cyclin D₁ protein expression are observed in the squamous cell carcinomas of the TAM67-expressing mice. Further investigation of this mechanism by Hennigan and Stambrook (24) established that a GFP-TAM67 fusion was able to arrest human fibrosarcoma cells in culture predominantly in the G₁ phase of the cell cycle, not by decreasing the expression of cyclin D₁ but by inhibiting the activation of cyclin D₁ and cyclin E kinase complexes. Unlike TAM67, however, the GFP-TAM67 failed to interact with other leucine zipper proteins. Recent findings in NIN3T3 mouse fibroblasts demonstrate that expression of a dominant negative c-jun is able to inhibit the activation of the cyclin D₁ promoter and that AP-1 activity is essential for the activation of the cyclin D₁ promoter by protein kinase C- and - (25). Together these results suggest that transcriptional activation of cyclin D₁ may not be the only role AP-1 plays in regulating the cell cycle. In Fig. 5, we show a decrease in the expression of cyclin D₁ in UVB-induced squamous cell carcinoma samples from TAM67 SKH-1 mice when compared to nontransgenic littermates, suggesting that transcriptional activation of cyclin D₁ by AP-1 is the active mechanism in our studies.

The cyclin D₁ promoter also contains NF-B sites (26), suggesting that cyclin D₁ may also be a target of NF-B as well as AP-1-dependent regulation. The proteins of the NF-B transcription factor family are known to regulate the transcription of many genes involved in cell cycle, cell proliferation, and apoptosis (27). It has also been reported that p65, the most transcriptionally active member of the NF-B family, is able to interact with Fos/Jun members of the AP-1 family (28). More recent investigations have identified transactivation of NF-B and AP-1 after exposure of TPA or TNF- to JB6 cells (29, 30). Inhibition of these transactivation events in the presence of the antioxidant pyrrolidine dithiocarbamate or by expressing a nondegradable mutant of IB suggests that transformation via TPA or TNF- is dependent on both of these transcription factor families. More recent investigations have suggested that TAM67 physically interacts with p65 in the nucleus of human keratinocytes and that the expression of TAM67 is able to inhibit the expression of NF-B and AP-1 target genes (31). Together, these investigations suggest that inhibition of UVB-induced tumor growth and burden in the SKH-1 mouse model via the expression of TAM67 may also be due in part to an inhibition of NF-B transactivation.

In conclusion, these observations from a SKH-1 hairless mouse system show that signaling pathways that are blocked by the expression of TAM67 play an important role in UVB-induced skin carcinogenesis. Previous studies examining tumor promotion by chemical agents or viral oncogenes have shown similar results as seen herein. Together, these data suggest that TAM67 blocks specific signaling pathways that are involved in both chemically and physically induced skin carcinogenesis. Further identification of the TAM67 target pathways is needed so that the search for chemopreventive agents may be directed toward compounds that inhibit these tumor-promoting events.

	Materials and Methods

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 
Breeding of Transgenic Mouse Lines
K14-TAM67 (13) and AP-1 Luc (32) mice were obtained from Dr. Colburn on a DBA/2 genetic background. These transgenes were bred onto the SKH-1 genetic background by crosses with SKH-1 mice obtained from the Charles Rivers Laboratories (Kingston, NY). Mice were used in experiments after generation N5. Heterozygous offspring carrying either the K14-TAM67 transgene, the AP-1 Luc transgene or both were identified by PCR analysis of tail DNA using the following primers: hK14 primers (GenBank accession no. U11076) bp 1693–1717 and 2205–2181, with H-Ras primers 7816 cacccccactaagcctgttgttttgcaggac and 7817 gctagccataggtggctcacctgtactgatg, or Luc primers gcggaatacttcgaaatgtcc and ccttaggtaacccagtagatcc (13).

RNA Isolation
Tissues for RNA expression were harvested from animals after CO₂ asphyxiation. For RT-PCR, skin sections were harvested from the back of the mouse and snap frozen in liquid nitrogen. The epidermal layer was separated from the whole skin sample and pulverized in liquid nitrogen with a mortar and pestle. The powdered epidermis was immediately placed in extraction buffer, homogenized, and the RNA extracted using the Totally RNA kit (Ambion, Austin, TX). The purified RNA was then DNase treated before undergoing RT-PCR analyses.

RT-PCR
Qiagen's protocol for Omniscript reverse transcriptase was used for performing two-tube RT-PCR. A total of 1 µg RNA per sample was primed using 200 ng of antisense primers for mouse GAPDH (5'-ggccctcctgttattatgg-3') and for the human growth hormone downstream of the TAM67 transgene (5'-tggataagggaatggttgg-3'). The resulting cDNA products underwent 40 cycles of PCR (94°C, 1 min, 55°C, 1 min, 72°C, 1 min) after an initial 72°C hot start before a 3-min denaturing step at 94°C. Sense primers used in these reactions were for GAPDH (5'-aagattgtcagcaatgcatcc-3') and for TAM67 (5'-aacatgctcagggaacagg-3'). Products were analyzed on a 1.5% agarose gel.

Assays of AP-1 Luc Activity
AP-1 Luc activity was measured in AP-1 Luc⁺/K14-TAM67^- mice and in their AP-1 Luc⁺/K14-TAM67⁺ siblings. Mice were anesthetized with Aventin at a dosage of 0.017 ml/g of body weight before three 1.5-mm skin punches were taken from the right ear. These samples were placed in liquid nitrogen before being stored at -80°C. The mice while anesthetized were treated with a UVB dose of 10 kJ/m². UVB exposure times were calculated using a UVX radiometer (Ultra-violet Products, San Gabrial, CA). Mice were euthanized 72 h post-UVB exposure, and 3 x 1.5 mm punches were taken from the left ears and treated and stored as before. A bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL) was performed on the ear punches and the Luc activity of the samples determined using 20 µg of protein.

Skin Carcinogenesis
Eight-week-old K14-TAM67⁺ mice and their negative littermates were exposed to UVB three times a week. The dose of radiation received was increased slowly over the first 6 weeks. Exposure was started at a dose of 2.5 kJ/m² with a dosage increase of 1.5 kJ/m² every week until the maximum dosage of 9 kJ/m² was achieved at the 6th week. The presence of UVB-induced tumors and the size of these tumors were measured weekly throughout the experiment and recorded. Treatments of 9 kJ/m² continued until the end of the study at 25 weeks when mice were euthanized, tumor samples collected, and prepared for analysis.

UVB Induction of Hyperproliferation and AP-1 Activation
Four K14-TAM67⁺ mice or four negative littermates per group were treated with 10 kJ/m² UVB under Aventin anesthesia. Dorsal skin samples were collected over a time period of 0–120 h posttreatment. Five-micrometer sections were stained with H&E and UVB-induced hyperplasia was determined from these H&E-stained slides. The distance from the top of the basement membrane to the bottom of the stratum corneum was measured (three measurements per field, 10 fields per sample). These distances were measured using the Pro image analysis program (Media Cybernetics, Silver Springs, MD).

Measurement of Cyclin D1 by Immunohistochemistry
Monoclonal mouse anti-cyclin D1 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Paraffin sections of tumors from the 25-week UVB exposure experiment were baked at 60°C for 1 h before being deparaffinized and placed in PBS. Slides were placed in Dako Target Retrieval Solution for 10 min, 98°C, and after cooling, immersed in 3% H₂O₂ for 5 min. Slides were processed with the "Mouse on mouse" detection kit (Vector Laboratories, Inc., Burlingame, CA) as directed by the company. The sections were incubated with anti-cyclin D₁ for 1 h (1:20 dilution) at room temperature. Samples were then incubated with a biotinylated anti-mouse antibody for 10 min at room temperature followed by incubation with VECTASTAIN ABC reagent for 5 min. Color development was achieved by incubation with liquid DAB (DAKO Corporation, Carpinteria, CA) for 10 min at room temperature. Slides were counterstained with hematoxylin and dehydrated before addition of coverslips. A positive reaction was observed as a brown precipitate and the percentage of cyclin D₁-expressing cells calculated from 10 random fields of view per slide.

Statistical Analysis
All values are expressed as mean ± SE. Statistical analysis was performed using the statistical analysis program Stata 7.0 (Statacorp 2001). For inhibition of UVB-induced AP-1-driven Luc activity in TAM67⁺ mice studies, three experiments were pooled for the statistical analysis. An analysis of covariance that explicitly modeled an experimental effect yielded essentially identical results (data not shown), confirming the stability of pooling the data. Comparisons were made between TAM67⁺ mice and their negative littermates at 25 weeks for tumor multiplicity and volume. For multiplicity, an unpaired t test was conducted on the raw data. For tumor volume at week 25, the distribution of the data was strongly right skewed, so an unpaired t test was conducted on logarithmically transformed tumor data. Additionally, post hoc analysis of the slopes over time for tumor multiplicity and volume were conducted using linear regression, conditioned on the time points at which graphical analysis showed trajectories departing from baseline levels. A square root transformation provided the best normalization and linear slope for tumor volume over the time period. For statistical analysis of cyclin D₁ levels in UVB-induced squamous cell carcinomas, the percentage of cyclin D₁ positively stained cells per tumor were averaged across all replicate fields to obtain a single reliable value. Comparisons between TAM67⁺ mice and their negative littermates were conducted at week 25 using an unpaired t test. Statistical significance of difference was assessed using an unpaired t test. In all studies, results were identified as statistically significant if P < 0.05.

	Acknowledgements

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 
We thank Nancy K. Hart and the other members of the Dr. David S. Albert's laboratory for help with the immunohistochemical and hyperplasia studies.

	Notes

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 
¹ National Institutes of Health Grants CA27502 and the Cancer Research Foundation of America Fellowship Grant.

Received May 5, 2003; revised June 30, 2003; accepted July 7, 2003.

	References

Top Notes Abstract Introduction Results Discussion Materials and Methods Acknowledgements References

 

1. Shea, C. R. and Parrish, J. A. Nonionizing radiation and the skin. In: G. L. A. (ed.), Physiology, Biochemistry and Molecular Biology of the Skin, pp. 910–927. New York: Oxford University Press, 1991.
2. Cole, C. A., Forbes, P. D., and Davies, R. E. An action spectrum for UV photocarcinogenesis. Photochem. Photobiol., 43: 275–284, 1986.[Medline]
3. de Gruijl, F. R., Sterenborg, H. J., Forbes, P. D., Davies, R. E., Cole, C., Kelfkens, G., van Weelden, H., Slaper, H., and van der Leun, J. C. Wavelength dependence of skin cancer induction by ultraviolet irradiation of albino hairless mice. Cancer Res., 53: 53–60, 1993.[Abstract/Free Full Text]
4. Bender, K., Gottlicher, M., Whiteside, S., Rahmsdorf, H. J., and Herrlich, P. Sequential DNA damage-independent and -dependent activation of NF-B by UV. EMBO J., 17: 5170–5181, 1998.[Medline]
5. Chen, W., Borchers, A. H., Dong, Z., Powell, M. B., and Bowden, G. T. UVB irradiation-induced activator protein-1 activation correlates with increased c-fos gene expression in a human keratinocyte cell line. J. Biol. Chem., 273: 32176–32181, 1998.[Abstract/Free Full Text]
6. Shaulian, E. and Karin, M. AP-1 in cell proliferation and survival. Oncogene, 20: 2390–2400, 2001.[Medline]
7. Jochum, W., Passegue, E., and Wagner, E. F. AP-1 in mouse development and tumorigenesis. Oncogene, 20: 2401–2412, 2001.[Medline]
8. Schreiber, M., Kolbus, A., Piu, F., Szabowski, A., Mohle-Steinlein, U., Tian, J., Karin, M., Angel, P., and Wagner, E. F. Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev., 13: 607–619, 1999.[Abstract/Free Full Text]
9. Bernstein, L. R. and Colburn, N. H. AP1/jun function is differentially induced in promotion-sensitive and resistant JB6 cells. Science, 244: 566–569, 1989.[Abstract/Free Full Text]
10. Domann, F. E., Jr., Levy, J. P., Finch, J. S., and Bowden, G. T. Constitutive AP-1 DNA binding and transactivating ability of malignant but not benign mouse epidermal cells. Mol. Carcinog., 9: 61–66, 1994.[Medline]
11. Brown, P. H., Alani, R., Preis, L. H., Szabo, E., and Birrer, M. J. Suppression of oncogene-induced transformation by a deletion mutant of c-jun. Oncogene, 8: 877–886, 1993.[Medline]
12. Domann, F. E., Levy, J. P., Birrer, M. J., and Bowden, G. T. Stable expression of a c-JUN deletion mutant in two malignant mouse epidermal cell lines blocks tumor formation in nude mice. Cell Growth & Differ., 5: 9–16, 1994.[Abstract]
13. Young, M. R., Li, J. J., Rincon, M., Flavell, R. A., Sathyanarayana, B. K., Hunziker, R., and Colburn, N. Transgenic mice demonstrate AP-1 (activator protein-1) transactivation is required for tumor promotion. Proc. Natl. Acad. Sci. USA, 96: 9827–9832, 1999.[Abstract/Free Full Text]
14. Thompson, E. J., MacGowan, J., Young, M. R., Colburn, N., and Bowden, G. T. A dominant negative c-jun specifically blocks okadaic acid-induced skin tumor promotion. Cancer Res., 62: 3044–3047, 2002.[Abstract/Free Full Text]
15. Lu, Y. P., Lou, Y. R., Yen, P., Mitchell, D., Huang, M. T., and Conney, A. H. Time course for early adaptive responses to ultraviolet B light in the epidermis of SKH-1 mice. Cancer Res., 59: 4591–4602, 1999.[Abstract/Free Full Text]
16. Robles, A. I., Rodriguez-Puebla, M. L., Glick, A. B., Trempus, C., Hansen, L., Sicinski, P., Tennant, R. W., Weinberg, R. A., Yuspa, S. H., and Conti, C. J. Reduced skin tumor development in cyclin D1-deficient mice highlights the oncogenic ras pathway in vivo. Genes Dev., 12: 2469–2474, 1998.[Abstract/Free Full Text]
17. Kim, A. L., Athar, M., Bickers, D. R., and Gautier, J. Stage-specific alterations of cyclin expression during UVB-induced murine skin tumor development. Photochem. Photobiol., 75: 58–67, 2002.[Medline]
18. Yamamoto, H., Ochiya, T., Takeshita, F., Toriyama-Baba, H., Hirai, K., Sasaki, H., Sakamoto, H., Yoshida, T., Saito, I., and Terada, M. Enhanced skin carcinogenesis in cyclin D1-conditional transgenic mice: cyclin D1 alters keratinocyte response to calcium-induced terminal differentiation. Cancer Res., 62: 1641–1647, 2002.[Abstract/Free Full Text]
19. Dong, Z., Birrer, M. J., Watts, R. G., Matrisian, L. M., and Colburn, N. H. Blocking of tumor promoter-induced AP-1 activity inhibits induced transformation in JB6 mouse epidermal cells. Proc. Natl. Acad. Sci. USA, 91: 609–613, 1994.[Abstract/Free Full Text]
20. Dong, Z., Crawford, H. C., Lavrovsky, V., Taub, D., Watts, R., Matrisian, L. M., and Colburn, N. H. A dominant negative mutant of jun blocking 12-O-tetradecanoylphorbol-13-acetate-induced invasion in mouse keratinocytes. Mol. Carcinog., 19: 204–212, 1997.[Medline]
21. Young, M. R., Farrell, L., Lambert, P., Awasthi, P., and Colburn, N. H. Protection against human papillomavirus type 16-E7 oncogene-induced tumorigenesis by in vivo expression of dominant-negative c-jun dagger. Mol. Carcinog., 34: 72–77, 2002.[Medline]
22. Rodriguez-Puebla, M. L., Robles, A. I., and Conti, C. J. ras activity and cyclin D1 expression: an essential mechanism of mouse skin tumor development. Mol. Carcinog., 24: 1–6, 1999.[Medline]
23. Wisdom, R., Johnson, R. S., and Moore, C. c-Jun regulates cell cycle progression and apoptosis by distinct mechanisms. EMBO J., 18: 188–197, 1999.[Medline]
24. Hennigan, R. F. and Stambrook, P. J. Dominant negative c-jun inhibits activation of the cyclin D1 and cyclin E kinase complexes. Mol. Biol. Cell, 12: 2352–2363, 2001.[Abstract/Free Full Text]
25. Soh, J. W. and Weinstein, I. B. Roles of specific isoforms of protein kinase C in the transcriptional control of cyclin D1 and related genes. J. Biol. Chem., 2003.
26. Soh, J. W. and Weinstein, I. B. Roles of specific isoforms of protein kinase C in the transcriptional control of cyclin D1 and related genes. J. Biol. Chem., in press, 2002.
27. Pahl, H. L. Activators and target genes of Rel/NF-B transcription factors. Oncogene, 18: 6853–6866, 1999.[Medline]
28. Stein, B., Baldwin, A. S., Jr., Ballard, D. W., Greene, W. C., Angel, P., and Herrlich, P. Cross-coupling of the NF-B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J., 12: 3879–3891, 1993.[Medline]
29. Li, J. J., Westergaard, C., Ghosh, P., and Colburn, N. H. Inhibitors of both nuclear factor-B and activator protein-1 activation block the neoplastic transformation response. Cancer Res., 57: 3569–3576, 1997.[Abstract/Free Full Text]
30. Hsu, T. C., Nair, R., Tulsian, P., Camalier, C. E., Hegamyer, G. A., Young, M. R., and Colburn, N. H. Transformation nonresponsive cells owe their resistance to lack of p65/nuclear factor-B activation. Cancer Res., 61: 4160–4168, 2001.[Abstract/Free Full Text]
31. Li, J. J., Cao, Y., Young, M. R., and Colburn, N. H. Induced expression of dominant-negative c-jun downregulates NFB and AP-1 target genes and suppresses tumor phenotype in human keratinocytes. Mol. Carcinog., 29: 159–169, 2000.[Medline]
32. Rincon, M. and Flavell, R. A. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J., 13: 4370–4381, 1994.[Medline]

This article has been cited by other articles:

				M. Durchdewald, J. Guinea-Viniegra, D. Haag, A. Riehl, P. Lichter, M. Hahn, E. F. Wagner, P. Angel, and J. Hess Podoplanin Is a Novel Fos Target Gene in Skin Carcinogenesis Cancer Res., September 1, 2008; 68(17): 6877 - 6883. [Abstract] [Full Text] [PDF]

				Q. Shen, I. P. Uray, Y. Li, Y. Zhang, J. Hill, X.-C. Xu, M. R. Young, E. J. Gunther, S. G. Hilsenbeck, N. H. Colburn, et al. Targeting the Activator Protein 1 Transcription Factor for the Prevention of Estrogen Receptor-Negative Mammary Tumors Cancer Prevention Research, June 1, 2008; 1(1): 45 - 55. [Abstract] [Full Text] [PDF]

				H. He, Q. Gu, M. Zheng, D. Normolle, and Y. Sun SAG/ROC2/RBX2 E3 ligase promotes UVB-induced skin hyperplasia, but not skin tumors, by simultaneously targeting c-Jun/AP-1 and p27 Carcinogenesis, April 1, 2008; 29(4): 858 - 865. [Abstract] [Full Text] [PDF]

				Q. Gu, G. T. Bowden, D. Normolle, and Y. Sun SAG/ROC2 E3 ligase regulates skin carcinogenesis by stage-dependent targeting of c-Jun/AP1 and I{kappa}B-{alpha}/NF-{kappa}B J. Cell Biol., September 7, 2007; 178(6): 1009 - 1023. [Abstract] [Full Text] [PDF]

				Q. Gu, M. Tan, and Y. Sun SAG/ROC2/Rbx2 Is a Novel Activator Protein-1 Target that Promotes c-Jun Degradation and Inhibits 12-O-Tetradecanoylphorbol-13-Acetate-Induced Neoplastic Transformation Cancer Res., April 15, 2007; 67(8): 3616 - 3625. [Abstract] [Full Text] [PDF]

				J. Y. Zhang, A. E. Adams, T. W. Ridky, S. Tao, and P. A. Khavari Tumor Necrosis Factor Receptor 1/c-Jun-NH2-Kinase Signaling Promotes Human Neoplasia Cancer Res., April 15, 2007; 67(8): 3827 - 3834. [Abstract] [Full Text] [PDF]

				D. Zhang, J. Li, K. Wu, W. Ouyang, J. Ding, Z.-g. Liu, M. Costa, and C. Huang JNK1, but not JNK2, is required for COX-2 induction by nickel compounds Carcinogenesis, April 1, 2007; 28(4): 883 - 891. [Abstract] [Full Text] [PDF]

				D. Zhang, L. Song, J. Li, K. Wu, and C. Huang Coordination of JNK1 and JNK2 Is Critical for GADD45{alpha} Induction and Its Mediated Cell Apoptosis in Arsenite Responses J. Biol. Chem., November 10, 2006; 281(45): 34113 - 34123. [Abstract] [Full Text] [PDF]

				M. J. Gerdes, M. Myakishev, N. A. Frost, V. Rishi, J. Moitra, A. Acharya, M. R. Levy, S.-w. Park, A. Glick, S. H. Yuspa, et al. Activator protein-1 activity regulates epithelial tumor cell identity. Cancer Res., August 1, 2006; 66(15): 7578 - 7588. [Abstract] [Full Text] [PDF]

				H.-S. Yang, C. P. Matthews, T. Clair, Q. Wang, A. R. Baker, C.-C. H. Li, T.-H. Tan, and N. H. Colburn Tumorigenesis Suppressor Pdcd4 Down-Regulates Mitogen-Activated Protein Kinase Kinase Kinase Kinase 1 Expression To Suppress Colon Carcinoma Cell Invasion Mol. Cell. Biol., February 15, 2006; 26(4): 1297 - 1306. [Abstract] [Full Text] [PDF]

				L. Li, K. Sampat, N. Hu, J. Zakari, and S. H. Yuspa Protein Kinase C Negatively Regulates Akt Activity and Modifies UVC-induced Apoptosis in Mouse Keratinocytes J. Biol. Chem., February 10, 2006; 281(6): 3237 - 3243. [Abstract] [Full Text] [PDF]

				M. A. Bachelor, S. J. Cooper, E. T. Sikorski, and G. T. Bowden Inhibition of p38 Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase Decreases UVB-Induced Activator Protein-1 and Cyclooxygenase-2 in a SKH-1 Hairless Mouse Model Mol. Cancer Res., February 1, 2005; 3(2): 90 - 99. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cooper, S. J. Articles by Bowden, G. T. Search for Related Content PubMed PubMed Citation Articles by Cooper, S. J. Articles by Bowden, G. T.